Labshake search
Citations for Agilent :
251 - 300 of 1416 citations for P N Nonylphenol 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Nhp6 was expressed as a N-terminal 6x His-tag fusion protein in E.coli BL21-CodonPlus (DE3)-RIL cells (Agilent). A colony of cells freshly transformed with plasmid p1035 was grown in 3 L of LB supplemented with 50 μg/mL ampicillin and 34 μg/mL chloramphenicol at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... N≥50 worms (10 worms/ well) were transferred to the Seahorse XF96 Cell Culture Microplate (Agilent Technologies, 101085-004) in a total volume of 180 uL ...
-
bioRxiv - Neuroscience 2023Quote: ... These pUAST-(G4C2)n vectors were amplified with a recombinase-mutated SURE®2 Escherichia coli strain (Agilent Technologies) at 28 °C for 72 hours to prevent repeat length contraction ...
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed twice and changed into Seahorse XF DMEM or RPMI medium (Agilent Technologies, 103680-100, 103681-100) containing 10 mM glucose ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Biochemistry 2024Quote: ... and L325A—were created using plasmids harboring the wild type GNNV-P sequence and a QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA). Mutations were confirmed by PCR sequencing (Genomics Inc. ...
-
bioRxiv - Genomics 2019Quote: The qualification and quantification estimations for each library were done after the last purification using DNA1000 chip (input ≥ 100 ng) or High Sensitivity chip (input < 100 ng) for BioAnalyzer (Agilent). After normalization the libraries were sequenced in 4-plex on HiSeq 2000 or HiSeq 2500 machines (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Cytokeratin 5/6 (mouse monoclonal) at 1:100 to 1:200 dilution for zebrafish tissue and 1:100 dilution for human tissue (Dako), GATA 3 (SAB2100898 ...
-
bioRxiv - Cell Biology 2023Quote: ... Solid phase extraction of peptides was performed using C18 reversed phase sorbent containing 100 μl pipette tips Bond Elut OMIX 100 μl C18 tips (Agilent, Santa Clara ...
-
bioRxiv - Biophysics 2021Quote: ... The plasmid encoding the protein fused with a His-tag at the N-terminus was transformed in BL21 DE3 pLysS strains (Agilent). Recombinant αE-catenin was expressed via isopropyl 1-thio-β-d-galactopyranoside (IPTG,Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere [11 ...
-
bioRxiv - Evolutionary Biology 2020Quote: A mutant version of hA5 with a single N-terminal Cys residues were generated via sitedirected mutagenesis using the QuikChange lightning system (Agilent). The Cys was introduced in the Ser-Asn tag leftover from TEV protease cleavage as Ser-Asn-Cys ...
-
bioRxiv - Biochemistry 2021Quote: Rat Kir6.1 and N-terminal FLAG-tagged (DYKDDDDK) SUR2B were first cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses in HEK293 cells according to manufacturer’s instructions63,64 ...
-
bioRxiv - Biochemistry 2021Quote: Tpm isoforms Tpm1.6 and Tpm3.1 (with and without Met-Ala-Ser at the N-terminus) were expressed in ArcticExpress(DE3) RIL cells (Agilent Technologies), grown in Terrific Broth (TB ...
-
bioRxiv - Biochemistry 2020Quote: ... Salmonella typhimurium MsbA (T561C in a C88A/C315A cysteine-less background) with an N-terminal poly-histidine-tag was expressed in BL21-CodonPlus (DE3)-RIPL (Agilent). Expression was induced with 1 mM IPTG for 4 hours at 30°C and membrane proteins were solubilized with 1% DDM and 0.04% sodium cholate in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 500 μl of culture headspace was sampled via gas-tight syringe and subject to gas chromatography through a HayeSep N column (Agilent) at 90°C in N2 carrier gas ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Biochemistry 2022Quote: ... or a FLAG tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was added on the N-terminus of MBP WT or R919* TRPA1 using Quikchange Lightning site-directed mutagenesis (Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Dried FAMES were redissolved in n-hexane and then quantified by gas chromatography (N6890, Agilent Technologies, Santa Clara, CA, USA) and identified with a MIDI Sherlock microbial identification system version 4.5 (MIDI Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT N-terminal point mutants were generated from pCR4 TOPO NOCT (Open Biosystems) and Quikchange site directed mutagenesis PCR (Agilent) to generate NOCT(1-431 ...
-
bioRxiv - Biochemistry 2019Quote: ... vector encoding the pG gene as reported previously26 was site-specifically mutated by the insertion of an N-terminal serine using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), according to the manufacturer’s instructions using following forward and reverse primers (ser codon underlined) ...
-
bioRxiv - Microbiology 2019Quote: ... a BglII restriction site within the linker-sequence separating the N-terminal mCherry-tag from hGBP1 was eliminated in pmCherry-hGBP1 by Quickchange Site Directed Mutagenesis (Agilent) using the oligomer pair pmCherry-hGBP1DBglII-F and -R (Table S9) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm, Agilent technologies USA). The injector was set at 220 °C and 1 μL injections were made with helium as carrier gas ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Microbiology 2022Quote: ... The copies of expressed hACE2 or SARS-CoV-2 N gene copies in individual tissues were interpolated based on threshold cycle (Ct) values determined using MxPro qPCR software (Agilent). A value of 1 was assigned if gene copies were below the detection limits.
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Molecular Biology 2023Quote: ... each reaction was diluted with 100μl 2X SSC and slot blotted using Bio-Rad Slot blot apparatus onto Hybond-N+ membranes (Amersham) which were UV crosslinked with autocrosslink settings (120mJ/cm2) of Stratalinker 1800 (Stratagene) apparatus ...
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Cancer Biology 2021Quote: ... and a mitochondrial stress test (Agilent, 103015-100) was carried out according to the manufacturer’s protocols using a Seahorse XFe96 analyser (Agilent ...
-
bioRxiv - Microbiology 2021Quote: The XF ATP Rate Assay (Agilent 103592-100) was used per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2mM glutamine (Agilent cat. no. 103579-100). For mouse vs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 μM Rotenone/Antimycin A (Agilent, 103015-100) were added at indicated timepoints ...
-
bioRxiv - Neuroscience 2020Quote: ... in Seahorse XF Base Medium (Agilent, 102353-100) supplemented with 0.18% glucose ...
-
bioRxiv - Immunology 2022Quote: ... and CD31 (JC70A, Dako M0823, dilution 1:100).
-
bioRxiv - Cancer Biology 2020Quote: ... pan-keratin (Dako; #M3515, IHC dilution 1:100), Ki67(Abcam ...
-
bioRxiv - Bioengineering 2020Quote: ... Mouse monoclonal IgG1 antibody (DAKO, X0931, 1:100) was used as a negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-VWF (1:100, GA527, Dako), rabbit polyclonal anti-SLC39A10 (1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For Mito Stress Test (Agilent kit 103015-100) 1 μM oligomycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... CD8 (clone C8/144B, dilution 1:100, Dako), HLA-DR + DP + DQ (MHCII ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD68 (clone M0876, Dako®, dilution 1: 100) and CD8 (clone ...
-
bioRxiv - Systems Biology 2021Quote: ... at 1:100 in Antibody Dilution Buffer (DAKO) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (1003579-100, Agilent Technologies). 3-5 x 105 cells per well were plated in XF24 Seahorse Biosciences plates pre-coated with Cell-Tak (354240 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 10 mM glucose (Agilent Technologies, 103577-100). Basal respiration was measured 3 times in the assay medium ...