Labshake search
Citations for Agilent :
51 - 100 of 6406 citations for Oxytocin ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... After centrifugation plate was incubated for 5 minutes before being loaded into a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Basal respiration was measured over six hours with 36 ten-minute protocol cycles including a ...
-
bioRxiv - Biochemistry 2023Quote: ... Colonies were stained with Wright-Giesma and plates were scanned using the Biotek Cytation 5 Imaging Multimodal Reader (Agilent). From scanned images ...
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.
-
bioRxiv - Cancer Biology 2022Quote: ... India for whole exome sequencing (Makiniemi et al.) using Agilent V6r2 (Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Whole cell reactions were performed in 2 mL glass HPLC vials (Agilent) charged with indole (final conc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Whole-exome sequencing was performed using SureSelect V4 exome probes (Agilent Technologies) and a HiSeq 2000 sequencer (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... Whole-exome sequencing was performed using SureSelect Human All Exon V7 (Agilent) according to manufacturer’s protocol and sequenced on an Illumina NextSeq 500 (paired-end 150 bp reads) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... seeded (25,000-50,000 cells/well) on Matrigel coated test plates (Extracellular Flux Assay Kit, Agilent) and cultured 4 days in maturation medium prior to measurement ...
-
bioRxiv - Pathology 2021Quote: ... Whole human genome oligonucleotide microarray (44K oligonucleotide DNA microarray, Agilent Technologies, Tokyo, Japan) was used for microarray experiments ...
-
bioRxiv - Cell Biology 2019Quote: Oxygen consumption of whole worms was measured using the Seahorse XF24 (Seahorse Bioscience) at room temperature (25 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... gene expression analysis was carried out by Agilent Whole Human 44K Genome Oligo Array (G4112A, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2021Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for an additional 20 min allowing cells to settle on the pre-dispensed gel ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...
-
bioRxiv - Bioengineering 2024Quote: ... Fluorescence was quantified using an excitation of 530/15 nm and emission of 590/15 nm on a fluorescent plate reader (BioTek Cytation 5, Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... DMMB solution was added (200 µL/well) and absorbance was measured at 540 nm and 590 nm using a plate reader (BioTek Cytation 5, Agilent Technologies). For all samples ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were sealed using a PlateLoc plate sealer (Agilent) with optical clear seal ...
-
bioRxiv - Microbiology 2020Quote: A customized whole-genome DNA microarray of 630Δerm was used (8×15K format, Agilent) (50) ...
-
bioRxiv - Biophysics 2022Quote: ... The clarified whole-cell extract was subjected to fluorescent size exclusion chromatography (Agilent HPLC) using a Superdex S200 column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... Whole supernatants were dried down and then desalted onto OMIX Pipette tips C18 (Agilent Technologies) until the mass spectrometric analysis.
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Biochemistry 2022Quote: ... Point mutants were introduced using whole plasmid amplification with Pfu Ultra II (Agilent, 600670-61) and complementary primers ...
-
bioRxiv - Immunology 2019Quote: ... and used as hybridization probe on Whole Human Genome Microarrays (Agilent Technologies, Palo Alto, CA). Only probes with signal values >60% quantile in at least one condition were considered for the differential gene expression (DGE ...
-
bioRxiv - Cancer Biology 2022Quote: ... 592 whole-gene targets were enriched using a custom-designed SureSelect XT assay (Agilent Technologies); a total of 1.4 MB was assessed ...
-
bioRxiv - Molecular Biology 2023Quote: ... range: 7.0–8.3) and 8.8 ± 0.6 (whole fish, range: 7.6–9.5) using TapeStation (Agilent Technologies). Although eRNA samples were somewhat degraded as indicated by lower RINe ...
-
bioRxiv - Bioengineering 2022Quote: ... and the plates were incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). The liquid cultures were centrifuged at 3500 rpm for 5 minutes (Sorvall Legend X1R M20 rotor ...
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). 108 colony-forming units (CFUs ...
-
bioRxiv - Bioengineering 2024Quote: ... and the plates were incubated at 37°C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Bioengineering 2024Quote: ... and the plate was incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 48 hours (Fig ...
-
bioRxiv - Bioengineering 2023Quote: ... we first seeded 2,000 cells in specialized Seahorse assay plates (Seahorse XF Cell Mito Stress Test Kit, Agilent) and incubated them for 24h at 33 °C for proliferation and for 7 days at 37 °C for maturation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako).
-
bioRxiv - Cancer Biology 2023Quote: ... Signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako).
-
bioRxiv - Neuroscience 2024Quote: ... mut-shM4 (Table 5) and the QuikChange Multi Site-Directed Mutagenesis kit (200514; Agilent; Manufacturer Instructions) in several assays until all the mutations were incorporated ...
-
bioRxiv - Epidemiology 2019Quote: ... OGTT plasma insulin concentrations were measured by ELISA (Dako UK Ltd., Ely, Cambs, U.K.). Intra-assay imprecision (CV ...
-
bioRxiv - Microbiology 2020Quote: ... Whole cell spectra of cell suspensions were conducted with a Cary 300 UV/Vis Spectrophotometer (Agilent).
-
bioRxiv - Microbiology 2021Quote: Whole venom fractionation was performed by reversed-phase high performance liquid chromatography (RP-HPLC) (Agilent 1200) on a C18 column (250 × 4.6 mm ...
-
bioRxiv - Cancer Biology 2021Quote: Whole-exome libraries for all samples were generated using the SureSelect XT Mouse All Exon (Agilent) target enrichment kit with 100 bp paired-end sequencing on the Illumina HiSeq 4000 platform ...
-
bioRxiv - Cancer Biology 2019Quote: ... The whole-exome sequencing libraries were prepared with the SureSelect Low Input Target Enrichment System (Agilent) and sequenced pair-ended on Illumina HiSeq ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA whole genome libraries were quantitated using the Agilent TapeStation D1000 (cat # 5067-5582, Agilent). Quantitation values and fragment lengths sourced from the TapeStation D1000 were used for quality control prior to hybridization capture reaction.
-
bioRxiv - Plant Biology 2023Quote: Whole-cells or PBS absorption spectra were recorded with a Varian Cary Bio 100 spectrophotometer (Agilent). Fluorescence spectra of isolated PBS samples were recorded with a fluorimeter (SpectraMax M2 ...