Labshake search
Citations for Agilent :
1 - 50 of 236 citations for Nucleic Acid Modification since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acids system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acid system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library quality was confirmed using the Agilent 2200 TapeStation Nucleic Acids System (Agilent).
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of nucleic acids was assessed with a Fragment Analyzer (Agilent, Switzerland) at the Lausanne Genomic Technologies Facility of the University of Lausanne.
-
bioRxiv - Biophysics 2022Quote: ... Nucleic acid purification was performed using a high-performance liquid chromatography (HPLC, Agilent 1100) equipped with a diode array detector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Cell Biology 2019Quote: A fluorescein-conjugated peptide nucleic acid (PNA) telomere detection kit for flow cytometry (Cat.#K5327, Dako) was used following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Cell Biology 2020Quote: Samples from all biological replicates were first sent to the Stanford University Protein and Nucleic Acid Facility (Stanford, CA) for quantification and quality analysis using a 2100 Bioanalyzer (Agilent). Samples were then sent to Novogene Corporation Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries were submitted to the VCU’s Nucleic Acid Sequencing core facility where the quality of the libraries was verified using the bioanalyzer (Agilent Technologies).
-
bioRxiv - Cancer Biology 2020Quote: ... The concentration of total RNA was measured on a Nanodrop device and the quality of the extracted nucleic acid was assessed using a Bio-analyzer 2100 (Agilent technologies, CA). Microarray probes were synthetized in one cycle of RNA amplification in which molecules were labeled (Affymetrix microarray station ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentration of total RNA was measured using a Nanodrop spectrophotometer and the quality of the extracted nucleic acid was assessed on a Bio-analyzer 2100 (Agilent Technologies, CA). Microarray probes was synthetized by one cycle of RNA amplification in which molecules were labeled in an Affymetrix microarray station (Affymetrix ...
-
bioRxiv - Systems Biology 2022Quote: ... the RNA integrity number was 10 as assessed by the Stanford Protein and Nucleic Acid (PAN) Biotechnology Facility using the RNA Nano Kit (Agilent #5067-1511) on an Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2019Quote: ... Nucleic acid concentrations were measured by NanoDrop ND-1000 spectrophotometer and RNA integrity was analyzed using Agilent 2100 Bioanalyzer (Agilent Technologies cat.# G2939BA).
-
bioRxiv - Cell Biology 2023Quote: ... Slides were incubated for 60 seconds in Modified Mayer’s Haematoxylin (Lillie’s Modification) (DAKO), washed for 5 minutes in tap water and immersed for 2 seconds in Eosin followed by washing in dH2O ...
-
bioRxiv - Cell Biology 2021Quote: ... Modifications of these plasmids were made using the QuikChange Lightning site-directed mutagenesis kit (Agilent). The C-termini were tagged with mGFP or mCherry to facilitate protein localization ...
-
bioRxiv - Pathology 2022Quote: ... This assay was performed following a previously described procedure [40] with minor modifications (the Dako Envision + system ...
-
bioRxiv - Biophysics 2022Quote: ... Mutagenesis and all DNA modifications were carried out using Pfu Ultra II Hotstart 2X Master Mix (Agilent). Mutagenesis primers for hIP3R1 F2586K forward (TCTTCATGGTCATCATCATTGTTCTTAACCTGATTAAGGGGGTTATCATTGACACT) ...
-
bioRxiv - Systems Biology 2020Quote: ... This modification was accomplished using the Stratagene Quick Change site-directed mutagenesis protocol (Stratagene, La Jolla, CA) with pNC1136 as template DNA and oligonucleotides pNC1136QC(PacI)_F and pNC1136QC_R as primers ...
-
bioRxiv - Genetics 2020Quote: ... Step 1.3 of the protocol was performed with the following modifications: Step 1.3.q slides were incubated in Dako bluing buffer (#CS70230-2 Agilent) for 30 s ...
-
bioRxiv - Cell Biology 2020Quote: ... MBP-Tlg21-327 and the co-expressed Vps45–Tlg2 proteins were expressed and purified in a similar manner with the following modifications: protein was overexpressed in BL21-Codon Plus (Agilent); after IPTG addition the cells were grown at 16°C ...
-
bioRxiv - Biophysics 2019Quote: ... An in-house modification to the pumping system allows faster equilibration of the pressures: a second Tri-scroll 800 pump (Agilent) was connected to the source region (with an Edwards SP16K connected to the front pumping line) ...
-
bioRxiv - Genetics 2019Quote: ... Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.1% medronic acid (Agilent), and Mobile phase B contained 90% acetonitrile and 0.1% medronic acid ...
-
bioRxiv - Biochemistry 2023Quote: ... Medronic acid was purchased from Agilent Technologies (Santa Clara).
-
bioRxiv - Molecular Biology 2020Quote: - Medronic acid (Cat# 5191-3940, Agilent Technologies)
-
bioRxiv - Physiology 2023Quote: ... Hepatic portal vein bile acids and short chain fatty acids were acquired using an Agilent 1290 series HPLC (Agilent,) with an Acquity C18 BEH (2.1mm x 50mm ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or with minor N-terminal truncations to exclude the transmembrane regions (Sphaeroforma arctica: amino acids 21-316; Auxenochlorella protothecoides: amino acids 21-327) in Arctic Express DE competent cells (Agilent). At the N-terminus ...
-
bioRxiv - Biochemistry 2022Quote: ... 6 - trisulfonic acid (ProZyme, Inc., San Leandro, CA) at the reducing termini by reductive amination ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100 ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Biophysics 2020Quote: ... Calibration curves of individual and mixed amino acids were prepared using either 250 pmol stocks of corresponding individual amino acids or a 250 pmol amino acid standard mix (Agilent #5061-3331). Quantification was performed using calibration curves of the respective amino acid standards.
-
bioRxiv - Biophysics 2021Quote: ... (buffer A: 0.1% trifluoro-acetic acid in water, buffer B 100% acetonitrile with 0.1% trifluoro-acetic acid; Agilent Zorbax 300SB-C18 column). Collected protein fractions were lyophilized and stored at −20 °C.
-
bioRxiv - Neuroscience 2020Quote: ... anti-glial acid fibrillary protein (GFAP) (Dako, 1: 1000). A classical astrocyte marker (Gomes-Leal et al. ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Genetics 2020Quote: ... The concentration of amino acids was determined by Agilent 1260 HPLC system ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.01% medronic acid (v/v, 5191-4506, Agilent). For the re-equilibration gradient ...
-
bioRxiv - Biochemistry 2019Quote: ... The p-coumaric acid and caffeic acid peaks were identified by comparing the retention times to authentic standards and by mass spectrometry (Agilent G6120, quadrupole MS). The integrated peak areas were converted to concentrations in mM based on calibration curves generated with authentic standards.
-
bioRxiv - Microbiology 2019Quote: ... The concentrations of the solvents (acetone, acetic acid, butyric acid, butanol, and ethanol) were determined using gas chromatography (7890A, Agilent, Wilmington, DE, USA). Isobutyl alcohol and isobutyric acid were used as the internal standards for solvent quantification.
-
bioRxiv - Biochemistry 2021Quote: ... The HPLC profile of tannic acid and gallic acid at both pH’s was obtained using an Infinity II HPLC system (Agilent Technologies, Santa Clara, CA) and an Agilent 5 prep-C18 column (50×21.2 mm ...
-
bioRxiv - Bioengineering 2023Quote: ... The optical purity of L-lactic acid and D-lactic acid were measured via a HPLC system (Agilent 1260 series, Hewlett-Packard, USA) equipped with a SCAS Sumichiral OA-5000 column (150 × 4.6 mm ...
-
bioRxiv - Cell Biology 2020Quote: ... for amino acids and an Eclipse Plus C18 (1.8 μm; Agilent) for TCA and PPP intermediates ...
-
bioRxiv - Microbiology 2021Quote: ... The fatty acid profiles were analyzed by gas chromatography (Agilent 7890A) using the RTSBA6 method/library ...
-
bioRxiv - Genetics 2021Quote: ... and organic acids by a dual-wavelength absorbance detector (Agilent G1314F).
-
bioRxiv - Physiology 2021Quote: Amino acid concentrations were determined with high-performance liquid chromatography (Agilent Technologies 1100 HPLC System ...
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Neuroscience 2022Quote: ... Anti glial fibrillary acid protein (Abcam, GFAP, Dako Z0334 1:1000); Anti CD68 (Biorad MCA1957 ...