Labshake search
Citations for Agilent :
1 - 50 of 883 citations for Nonanoic acid reaction products with diethanolamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Reaction products were quantified on an HPLC system from Agilent equipped with a Hypersil ODS-2 C18 column (250 × 4 mm) ...
-
bioRxiv - Genetics 2020Quote: ... Amplification reaction products were purified by AMPure Beads Purification (Agilent).
-
bioRxiv - Microbiology 2020Quote: ... the reaction products were analyzed by liquid chromatography (Agilent Technologies)-mass spectrometry (BRUKER ...
-
bioRxiv - Microbiology 2024Quote: Reaction products were analyzed using the 1460 HPLC system (Agilent) with a diode array detector at 260 nm ...
-
bioRxiv - Molecular Biology 2021Quote: Products from digestion-ligation or Gibson assembly reactions were XL10-Gold ultracompetent bacteria (Agilent). DNA was isolated from bacterial colonies using the Miniprep kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR reaction products were analyzed using a 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany). The skipping efficiency was determined from the molarity of the PCR products by the following expression ...
-
bioRxiv - Biochemistry 2021Quote: ... The enzymatic reaction product was further analyzed by high performance liquid chromatography (Agilent HPLC system (1260 Infinity II) equipped with UV-Vis DAD detector on a C-18 reverse-phase column (Phenomenex ...
-
bioRxiv - Immunology 2020Quote: ... The PCR product was digested in a 50ul reaction as previously described and full digestion confirmed by Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction products were analyzed through microfluidic electrophoresis in an Agilent Model 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA).
-
bioRxiv - Genomics 2021Quote: ... 4 μl of the purified product were amplified in multiple 100 μl reactions using Herculase II Fusion DNA Polymerase (Agilent) following the manufacturer’s specifications with 0.3 μM of the IS5/IS6 primers ...
-
bioRxiv - Biochemistry 2021Quote: ... The product of each mutagenesis reaction was transformed into XL1-Blue Electroporation-Competent Cells (Agilent Technologies, Santa Clara, CA, USA) and serial dilutions were plated to determine the total number of colonies ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.5 μL of the mutagenesis reaction was transformed into SoloPack Gold supercompetent cells following the manufacturer’s protocol (Product Number 230350, Agilent, Wilmington, DE). After a 1 hour recovery ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids pLB21 and pLB24 were used to further exchange the minD isoleucine 260 to glutamic acid (I260E) by QuickChange site-directed mutagenesis reaction (Stratagene) with oligonucleotide pair HS205/HS206 ...
-
bioRxiv - Biochemistry 2020Quote: ... A 1.0 μL sample of the end product or reaction mixture was applied to a silica gel-based iTLC strip (iTLC-SG; Agilent, Santa Clara, CA, USA) and developed with 50 mM citric acid ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library products were assessed by Agilent Bioanalyzer HS DNA assays (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cloned using StrataClone PCR cloning kit (product no: 240205, Agilent technologies Sweden AB, Kista) and re-amplified with M13F/M13R primers using DreamtTaq (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2024Quote: ... PCR products were cloned using StrataClone PCR cloning kit (product no: 240205, Agilent Technologies Sweden AB, Kista) and reamplified with M13F/M13R primers using DreamtTaq (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... Each 50μL reaction consisted of 10μL of 5X Herculase II Reaction Buffer (Agilent #600675), 34.5μL of nuclease-free water ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20μl 5X Reaction Buffer (Agilent), 10μg of gDNA and nuclease-free water to bring the total reaction volume to 100μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... The final product was quantified by Agilent Bioanalyzer DNA High-sensitivity Assay (Agilent 5067-4626 ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were confirmed by Tapestation (Agilent), and cleaned up with ExoSAP-IT (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Following QuikChange reaction (Stratagene, Moscow, Russia) with the corresponding primers (see Table S2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acids system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acid system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Medronic acid was purchased from Agilent Technologies (Santa Clara).
-
bioRxiv - Genomics 2020Quote: ... PCR3 products were PCR-purified and Tapestation (Agilent) was used to quantify and pool samples for NGS.
-
bioRxiv - Microbiology 2021Quote: ... Ligation products were transformed into XL10 cells (Agilent). Colonies containing recombinant genomes were isolated ...
-
bioRxiv - Microbiology 2020Quote: ... coli v.2 (Agilent product number G4813A-020097) and gDNA extraction is described in detail in (Submitted dataset to DiB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The capture library products were assessed by Agilent Bioanalyzer DNA 1000 assays (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The capture library products were assessed by Agilent Bioanalyzer DNA 1000 assays (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... This product was quantified using a Bioanalyzer (Agilent) and sequenced on an Illumina HiSeq-4000 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... 15 mM acetic acid and 2.5 µM medronic acid (5191–4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Plant Biology 2024Quote: ... FENGC amplification products were purified and product quality and quantity were determined using Agilent TapeStation D1000 system (Agilent, Santa Clara, USA) and Qubit 3 Fluorometer (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... Reactions were conducted in a total volume of 20 μl in a 96-well optical reaction plate (Stratagene). RT-PCR conditions were as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... The reactions were analyzed using HPLC (Agilent 1100 ...
-
bioRxiv - Biochemistry 2024Quote: ... These samples were desalted using preequilibrated (3x 15 µL of 50% ACN 0.2% Formic acid then 3X 15 µL 0.2% formic acid) Cleanup C18 pipette tips (Agilent) by pipetting 15 µL of the acidified solution 10X to ensure full binding of the peptides to the C18 plug in the tips ...
-
bioRxiv - Molecular Biology 2020Quote: - Medronic acid (Cat# 5191-3940, Agilent Technologies)
-
bioRxiv - Synthetic Biology 2020Quote: ... Pooled PCR products were purified with AMPure beads (Agilent), and 5ng of the purified pools was barcoded with Fluidigm Access Array barcodes using AccuPrime II (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were resolved on a TapeStation 4200 (Agilent) and bands were quantified with TapeStation Systems Software v3.2 (Agilent).
-
bioRxiv - Genomics 2022Quote: ... The PCR products were visualized on a TapeStation (Agilent). PCR products were electrophoresed on a 2% agarose gel ...
-
bioRxiv - Genomics 2022Quote: ... Size distribution of amplified products was analyzed by Agilent High Sensitivity DNA kit with Agilent 2100 Bioanalyzer or MultiNA system (Shimazu ...
-
bioRxiv - Bioengineering 2022Quote: ... The products were identified by a GC (Agilent 7890B) mass spectrometer (MS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were quantified on 2100 Analyzer instrument (Agilent), heat-denatured and circularized by a splint oligo sequence to generate circular DNA nanoball (DNB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The product was purified with 1x SPRI beads (Agilent) and quantified by nanodrop ...
-
bioRxiv - Molecular Biology 2024Quote: ... The EpiSwitch Explorer array (Agilent Technologies, Product Code 087165), containing 60-mer oligonucleotide probes was designed to interrogate potential 3D genomic interactions ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were resolved on a TapeStation 4200 (Agilent) and bands were quantified with TapeStation Systems Software v3.2 (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA library products were validated with TapeStation (Agilent Technologies), by using High Sensitivity D5000 ScreenTape and analyzing with TapeStation analysis software version 3.1 ...
-
bioRxiv - Immunology 2023Quote: ... Reactions were performed in a 25 μl reaction mix comprising 1X Taqman Brilliant III master mix (Agilent, Stockport, UK), 0.2 pmol/μl forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Molecular Biology 2024Quote: All PCR reactions were completed using a 50 ul reaction containing: 0.5 ul PFuUltra II fusion HS DNA Polymerase (Agilent), 1 % PFu Ultra reaction buffer ...