Labshake search
Citations for Agilent :
51 - 100 of 655 citations for Nipah Virus Glycoprotein F Recombinant Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 50 μL virus/antibody mixture and controls were added to HuH-7.5 cell culture monolayers in 96-well ePlates (Agilent) and incubated for 1 hr at 37°C ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Each annealed oligonucleotide was ligated into the adeno-associated virus (AAV2) plasmid (pAAV-EGFP-shRNA; Stratagene, La Jolla, CA)(Hommel et al. ...
-
bioRxiv - Biophysics 2020Quote: ... The recombinant construct was transformed into Arctic express (DE3) competent cells (Agilent Technologies, USA). The transformed cells were grown at 37°C in LB media supplemented with 100 μg/ml ampicillin and 10 μg/ml gentamycin ...
-
bioRxiv - Biophysics 2019Quote: ... The recombinant plasmid was subsequently transformed into Escherichia coli BL21 (DE3) cells (Agilent Technologies) for protein expression ...
-
bioRxiv - Biophysics 2023Quote: ... The resultant recombinant plasmids were transformed into ultra-competent ArcticExpress (DE3) cells (Agilent Technologies). ArcticExpress cells are derived from BL21(DE3) ...
-
bioRxiv - Immunology 2019Quote: ... Calibration beads were stained with F(ab’)2 FITC-Conjugated Goat Anti-Mouse immunoglobulins (Dako, F0479) at 1:50 dilution for 1 hr at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein blocking was performed using protein block solution (DAKO) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... UV-inactivation was carried by irradiation of virus-containing supernatant in a 15cm plate prior the concentration step in Stratalinker 1800 (Stratagene) at the standard power for 3 times 3min with swirling of the plate between each round ...
-
bioRxiv - Neuroscience 2023Quote: ... woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and SV40 polyadenylation signal was assembled using a modified helper-free system (Stratagene) as a serotype 2/1 (rep/cap genes ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vector was produced using HEK293 T-cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15 cm dishes (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vectors were produced using HEK293 T cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15-cm dishes (Corning ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant production/purification: The MLucV construct was expressed in BL21-CodonPlus (DE3)-RIPL strain (Agilent) using ampicillin and chloramphenicol as the selection antibiotic ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylated recombinant NS1 was purified by FPLC and then tetramerized to fluorochrome-conjugated streptavidin (Prozyme). To detect NS1-specific B cells ...
-
bioRxiv - Biophysics 2023Quote: Recombinant Pil1 and Pil1-mCherry were expressed in BL21(DE3)pLysS (#200132, Agilent Technologies Inc.) in auto induction LB medium (#AIMLB0210 ...
-
bioRxiv - Molecular Biology 2019Quote: Mutations were created via QuickChange site-directed mutagenesis of pcDNA5FRT/TO/F-Cherry-HCF-2FL (Agilent Technologies). Generation of the F-Cherry-HCF-2 Fn3c fragment and its derivatives was done by deletion and point mutagenesis ...
-
bioRxiv - Immunology 2019Quote: ... The Dynabeads were then stained with F(ab’)2 FITC-Conjugated Goat Anti-Mouse Immunoglobulins (Dako, F0479) at 1:50 dilution for 1 hr ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Bioengineering 2023Quote: ... protein block with Dako protein block solution (Dako, Glostrup, Denmark), incubation with primary antibodies [eGFP (Abcam ...
-
bioRxiv - Immunology 2020Quote: ... by placing the virus for 2 minutes in a UV Stratalinker 2400 equipped with 365 nm long-wave UV bulbs (Stratagene, USA). UV-inactivation was confirmed by lack of cytopathic effect on BSC-1 cells infected with i-VACV for up to 3 days (data not shown).
-
bioRxiv - Cancer Biology 2019Quote: ... protein block (Dako) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Protein Block (Agilent) was used to block nonspecific antibody binding before incubating the sections with primary antibody overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the recombinant adenovirus vector was produced using AdEasy (Ad) Vector System (Stratagene, La Jolla, CA, USA). The infection controls were Ad-GFP.
-
bioRxiv - Microbiology 2022Quote: ... coli XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)]) (Stratagene) was used for general cloning and E ...
-
bioRxiv - Biophysics 2019Quote: ... A sinusoidal potential (f = 80 Hz) was applied to the ITO slide with a function generator (33521A, Agilent) and a potentiostat (AFCBP1 ...
-
bioRxiv - Biophysics 2021Quote: ... coli (genotype: recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F’ proAB lacIqZΔM15 Tn10(Tetr)]) from Agilent Technologies were used for cloning ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... Repeated washes were performed before incubation with secondary antibody (FITC-labelled swine anti-rabbit F (ab’)2 (Dako) or Alexa Fluor 647-labelled goat anti-rabbit IgG (Molecular Probes ...
-
bioRxiv - Biochemistry 2023Quote: ... coli (genotype: recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F’ proAB lacIqZΔM15 Tn10(Tetr)]) from Agilent Technologies were used for cloning ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Cell Biology 2021Quote: ... and recombinant adenovirus particles were produced following the AdEasy XL Adenoviral Vector System protocol (#240010 Agilent Technologies). Islets were transduced using a microfluidic device to obtain uniform infection of the islet cells throughout the islet volume and were incubated overnight before imaging ...
-
bioRxiv - Bioengineering 2019Quote: N-linked glycans were released from purified antibody samples by overnight incubation with N-Glyccosidase F (Prozyme, GKE-5006B). The proteins were removed using LudgerClean glycan EB-10 cartridges (Ludger ...
-
bioRxiv - Immunology 2020Quote: ... protein block (Dako X0909) for 20 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... and Protein block (Dako) before staining with anti-pS6 (detected with fluorochrome conjugated secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... Influenza A virus inactivation was performed by delivering 2400 μJ/cm2 of UV light (254 nm) using a Strata linker 1800 (Stratagene, La Jolla, CA.). Virus inactivation was verified by plaque assay ...
-
bioRxiv - Microbiology 2020Quote: FITC-conjugated rabbit F(ab’)2 anti-human C1q was obtained by digestion of FITC-conjugated rabbit anti-human C1q (Dako) using 1 U/ µg of recombinant His-tagged IdeS protease ...
-
bioRxiv - Developmental Biology 2022Quote: ... the sections were washed twice in TTBS buffer before incubation in a diluted solution of Fluorescein (FITC) conjugated F (ab’)₂ fragment goat anti-rabbit IgG (Dako) or Alexa Fluor 647 conjugated F(ab)2 fragment swine anti-rabbit secondary antibody (Molecular Probes) ...
-
bioRxiv - Cell Biology 2021Quote: ... The pST39-BLOC-1 plasmid encoding recombinant BLOC-1 was transformed into BL21gold(DE3)plysS cells (230134, Agilent). Several colonies from the plate were inoculated into a starter culture of 10 ml LB supplemented with 34 μg/ml chloramphenicol and 100 μg/ml ampicillin that was grown overnight at 37 °C with moderate shaking ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant adeno-associated viruses (AAVs) with serotype 8 were produced using the AAV helper-free system (Agilent Technologies). Human embryonic kidney (HEK ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10-minute protein block step with Serum-Free Protein Block (X0909, Agilent DAKO) to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10-minute protein block step with Serum-Free Protein Block (X0909, Agilent DAKO) to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein Blocking reagent (Dako, X0909) and Bloxall blocking solution (Vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... dry protein A cartridges (Agilent) were primed in PBS at 300 μL/min before loading 1 mg of antibody at 1 mg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein Blocking reagent (Dako, X0909) and Bloxall blocking solution (Vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... blocked in Protein block (DAKO) for 10min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... BSA and Protein block (Dako). Sections were stained with primary antibodies against GFP (ab290 ...
-
bioRxiv - Microbiology 2022Quote: ... (F- ompT hsdS(rB- mB-) dcm+ Tetr gal λ(DE3) endA Hte [argU proL Camr] [argU ileY leuW Strep/Specr]) (Stratagene) was used for recombinant protein expression.
-
bioRxiv - Biochemistry 2021Quote: ... was added to a final concentration of 0.5% along with 2 µL of PNGase F Ultra (Agilent Technologies, Santa Clara, CA) and incubated for 1 hour at 37 °C before subsequent 2-AB/2-AA labelling ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Plant Biology 2021Quote: ... Grown colonies were screened with colony PCR using CP-F and UnivR primers and KAPA2G Robust HotStart Kit (Agilent, Supplemental Method 2). Sanger sequencing of the selected clone confirmed correct sequence of the PVY-coding part and correct in-frame insertion of GFP coding sequence ...