Labshake search
Citations for Agilent :
1 - 50 of 526 citations for N Ethyl Benzamid 3 carboxylate 15N 13C2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 15N-labeled metabolite analysis was performed using LC-TOF G6230A (Agilent Technologies) instrument equipped with 1290 Infinity HPLC system ...
-
bioRxiv - Microbiology 2023Quote: ... HT29 SGG UCN34 (n=3) were checked on RNA 6000 Nano chips (Bioanalyzer, Agilent) for quality and integrity ...
-
bioRxiv - Biochemistry 2020Quote: ... 1D 15N T1/T2 relaxation spectra were processed and analyzed with VnmrJ v4.2 (Agilent Inc). Macro “tc” (wiki.nesg.org ...
-
bioRxiv - Biochemistry 2023Quote: ... CLEANEX and DOSY data were collected on 100 μM 15N-labelled protein at a proton Larmour frequency of 600 (Agilent) or 800 (Bruker ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Molecular Biology 2020Quote: All 2D heteronuclear 15N-1H NMR experiments were acquired on a 11.75 Tesla Varian 500 MHz VNMRs system (Agilent Technologies Inc., Palo Alto, CA) with an operational frequency of 499.84 MHz ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Biophysics 2022Quote: ... a N-STORM 647 nm laser (Agilent), an iXon 897 Ultra EMCCD (Andor Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cat N° R37605) for 20 min and coverslips were mounted with Fluorescence Mounting Medium (Dako, Glostrup, Denmark, Cat N° S3023), while wells in the device were sealed with one drop of mounting medium per well before acquiring images ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Microbiology 2020Quote: ... and re-dissolved and diluted in ethyl acetate for analysis on an Agilent 7890A-5977B GC-MS system (Agilent Technologies, Inc., CA). Sample solution (1 μL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 100 μL of the ethyl acetate phase was transferred into a GC vial with insert and 1 μL was analyzed using GC 8890 (Agilent Technologies, USA) equipped with a flame ionization detector (FID ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Biochemistry 2022Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 800 µL sample and MTBSTFA (100 µL, N-tert-butyldimethylsilyl)-N-methyltrifluoroacetamide) were transferred to amber capped glass vials (Agilent Technologies, USA), heated to 80 °C for 20 min ...
-
bioRxiv - Microbiology 2022Quote: ... consisting of a model 6890 N gas chromatograph (Agilent).
-
bioRxiv - Bioengineering 2023Quote: ... and n-caprylate by an Agilent 7890B GC (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-IgL (Clone: N/A; 1:400; Agilent; #GA507), and anti-IgK (Clone ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dried samples were dissolved in ethyl acetate and acquired using Agilent 7000C triple quad mass spectrometer and Agilent 7890 GC (Agilent, Santa Clara, CA). 1μL sample was injected using Agilent 7693 auto-sampler injector operated in electron capture negative ionization (ECNI ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-labelled goat anti-mouse immunoglobulin (cat. n° P0447, Dako). The following antibodies were used for flow cytometry ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-IgK (Clone: N/A; 1:4000; Agilent; #A0191). Optimization of the antibodies and staining conditions was carried out on sections of human tonsil ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cancer Biology 2020Quote: ... Immunostaining was detected using 3,3’-diaminobenzidine (Agilent Dako, Cat # N-1939) peroxidase chromogen substrate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunostaining was detected using 3,3’-diaminobenzidine (Agilent Dako, Cat # N-1939) peroxidase chromogen substrate ...
-
bioRxiv - Cell Biology 2021Quote: ... The N-terminal region was removed by a Quikchange reaction (Agilent), and the resulting shortened fragment was inserted into the pDEST-HisMBP destination vector via a Gateway reaction.
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-labelled goat anti-mouse immunoglobulin (IgG; cat. n° P0447, Dako). The following antibodies were used for flow cytometry ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were coverslipped using Di-N-Butyle Phthalate in xylene (DPX, Dako).
-
bioRxiv - Microbiology 2020Quote: ... 0.4μg of M and 0.8μg of N) using GeneJammer transfection reagent (Agilent). Medium was replaced 16h post-transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by O/N incubation of primary antibody (GFAP (1:500, Dako) in 2% BSA ...