Labshake search
Citations for Agilent :
1 - 50 of 4338 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-IgL (Clone: N/A; 1:400; Agilent; #GA507), and anti-IgK (Clone ...
-
bioRxiv - Immunology 2022Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere [11 ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-IgK (Clone: N/A; 1:4000; Agilent; #A0191). Optimization of the antibodies and staining conditions was carried out on sections of human tonsil ...
-
bioRxiv - Cell Biology 2024Quote: Respirometry of intact cells (n = 5–8 per cell line) was measured with a Seahorse Analyzer (Agilent) following the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2) anti-fibrinogen (1/500) (Dako, A008002-2), 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by O/N incubation of primary antibody (GFAP (1:500, Dako) in 2% BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by horseradish peroxidase (HRP)-conjugated anti-mouse antibodies (Cat. N. P044701-2, Agilent Technologies LTD, Cheadle, UK) (2.4μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Neuroscience 2023Quote: ... These pUAST-(G4C2)n vectors were amplified with a recombinase-mutated SURE®2 Escherichia coli strain (Agilent Technologies) at 28 °C for 72 hours to prevent repeat length contraction ...
-
bioRxiv - Physiology 2024Quote: ... the flies were cold anesthetized and collected into an amber glass 2 mL vial (Agilent, P/N 5190-9590) fitted with a 150 µL glass insert (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... bordered (∼ 5 x 2 cm rectangle) with a hydrophobic fat pen (Dako). A glass coverslip ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Microbiology 2021Quote: ... for 5 minutes at room temperature and Oligo aCGH Wash Buffer 2 (Agilent) for 1 minute at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... Grids were then washed with PBS and blocked with 1% FBS for 5 min Grids were subsequently incubated with rabbit anti-CEA (Dako, supplemental table 2) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM Pyruvate and 2 mM Glutamine (Agilent; 103015-100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-GFAP (1:5,000, Dako, Z033401-2). The next day ...
-
bioRxiv - Immunology 2021Quote: ... stained with hematoxylin (Agilent, S330930-2, 1 mL), and incubated at room temperature for 7 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, 1:1000, Agilent). All commercial antibodies are validated by vendors ...
-
bioRxiv - Neuroscience 2024Quote: ... For GFAP (1:1000, Agilent Technologies, Z033429-2), Iba1 (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-CD31 (1:200 dilution, M082329-2, Dako), Goat anti-Rabbit IgG Cross-Adsorbed Secondary Antibody ...