Labshake search
Citations for Agilent :
201 - 250 of 8867 citations for Mouse Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 2nd Ab: anti-mouse (Agilent Dako, P0447, 1:1500).
-
bioRxiv - Molecular Biology 2023Quote: ... and revealed with anti-mouse (Dako P0447, 1/5000) or anti-rabbit (Jackson Immuno Research 111-035-003 ...
-
bioRxiv - Biochemistry 2023Quote: ... GST and GST-fused CBS-pair domain of murine CNNM2 were expressed in transformed BL21 (DE3) cells (Stratagene, CA). Bacterial cells were lysed by sonication in ice-cold PBS containing 1% Triton X-100 and protease inhibitor phenylmethylsulfonyl fluoride (Sigma–Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... they were then washed three time in PBS containing 0.1% tween 20 and incubated 1h with a rabbit anti-mouse antibody conjugated with horseradish peroxidase (HRP) (Dako). The activity of HRP was revealed by enhanced chemiluminescence (Perkin-Elmer).
-
bioRxiv - Developmental Biology 2023Quote: Whole-mount immunostaining of differentiated skeletal muscle cells was performed using the monoclonal hybridoma 12/101 primary antibody [38] (1/200 dilution; DSHB #AB-531892) and the EnVision+ Mouse HRP kit (Agilent Technologies, K4007) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Immunology 2023Quote: ... using 1 µg/mL of rat anti-mouse IgM (AbD Biotec) or rabbit anti-mouse IgG1 (Dako) capture antibody ...
-
bioRxiv - Microbiology 2019Quote: ... Mutations in the sgRNA binding sites were introduced by site directed mutagenesis (Stratagene) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The nonspecific binding of antibodies was blocked using 10% normal goat serum (DAKO) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Immunology 2022Quote: For the analysis of Fcγ-receptor binding PE-Streptavidin (Agilent Technologies, CA, USA) was coupled to recombinant and biotinylated human FcγR2A ...
-
bioRxiv - Microbiology 2023Quote: ... followed by saturation of nonspecific binding sites with normal goat serum (X0907; Agilent) applied for 25 min at room temperature ...
-
Short-range interactions between fibrocytes and CD8+ T cells in COPD bronchial inflammatory responsebioRxiv - Pathology 2023Quote: ... Nonspecific binding was minimized by incubating the sections with 4% Goat Serum (Agilent) for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-glial fibrillary acidic protein (GFAP, 1:1,000, DAKO), mouse anti-4A4 (1:2,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... glial fibrillary acidic protein (GFAP) diluted 1:2000 (Dako, Z0334), PDGFRA diluted 1:200 (Cell Signaling ...
-
bioRxiv - Neuroscience 2022Quote: ... Glial Fibrillary Acidic Protein (GFAP, rabbit, 1:300, Dako, Z0334); Ionized calcium-binding adapter molecule 1 (Iba1 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit glial fibrillary acidic protein GFAP (DAKO, ZO334, 1:1000), chicken GFP (Abcam ...
-
bioRxiv - Genetics 2021Quote: ... glial fibrillary acidic protein (GFAP; polyclonal 1:1000, ZO334, DAKO-Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... and Glial fibrillary acidic protein (GFAP, 1:1000, Dako, G9269). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-rabbit glial fibrillary acidic protein (GFAP) (1:1000, Dako), and anti-mouse S100β (1:200 ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: ... Fluorescence spectra of proteins containing ZnPPIX were measured from 550-750 nm in a Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 430 nm ...
-
bioRxiv - Bioengineering 2021Quote: ... Serotec) mouse monoclonal antibodies, or Aβ40 (1:200, Covance), Iba-1 (1:200, Wako) and GFAP (1:1000, DAKO) rabbit polyclonal antibodies ...
-
bioRxiv - Physiology 2021Quote: ... Dako Animal Research Kit for mouse primary antibodies (Dako Diagnóstico S.A., Spain) was used for the qualitative identification of antigens by light microscopy ...
-
bioRxiv - Immunology 2019Quote: ... The sections were incubated in the kit polymer-HRP anti-mouse (Dako En Vision+ System-HRP ...
-
bioRxiv - Microbiology 2019Quote: ... Vectors containing mutant riboswitch alleles were generated with the QuickChange Site-Directed Mutagenesis Kit (Agilent) and mated into V ...
-
bioRxiv - Biophysics 2019Quote: Human CAMSAP1 residues 1474-1613 encompassing the CKK domain (HsCKK) were cloned into pET28a vector and expressed in BL21(DE3) cells (Stratagene). Following purification via immobilized metal-affinity chromatography (IMAC ...
-
bioRxiv - Immunology 2019Quote: ... mutant with Cys20 to Arg and Cys23 to Ser mutations in the RING1 domain was made by site-directed mutagenesis using Quickchange (Stratagene) with primers CCGCTGGTGTCTAGAAAGCTCAGTCTTGGGGAGTAC and GTACTCCCCAAGACTGAGCTTTCTAGACACCAGCGG ...
-
bioRxiv - Cell Biology 2020Quote: ... The cytoplasmic and KASH domains of the mini-nesprin constructs were obtained from a previous publication.22 The mutant domain was made from this construct by site-directed mutagenesis (Quikchange II XL, Agilent). The DN-KASH construct was made by ligation after digestion by ClaI of a PCR product from the mini-nesprin construct ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Cell Biology 2020Quote: ... including glutathione S-transferase (GST)-NEPH1 cytoplasmic domain (CD) and GST-NEPHRIN CD were expressed and purified from Escherichia coli BL21 cells (Stratagene). Purified phosphorylated GST-NEPH1 was expressed and purified from TKB1 cells (Stratagene) ...
-
bioRxiv - Cancer Biology 2021Quote: ... first an AgeI cut-site was knocked into the pcDNA3.1-Myoferlin-HA plasmid immediately prior to the transmembrane domain by site-directed mutagenesis (Agilent: 210518). Second ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, California), rabbit anti-S100β (1:400 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, CA) and rabbit anti-S100 (1:400 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, CA) and rabbit anti-S100 (1:400 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse α-PCNA (1:500 with antigen retrieval, Dako M087901), rabbit α-L-Plastin (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... a secondary goat-anti-mouse HRP antibody (1:1000, Dako) was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... Biotinylated goat-anti-mouse (Dako, Glostrup, Denmark; E0433; 1:200) was used as secondary antibody (1 h ...
-
bioRxiv - Genomics 2020Quote: ... and mouse monoclonal anti-CD31 antibody (1:50, DAKO, M0823) was conducted using goat-anti-rabbit Alexa-488 and goat-anti-mouse Alexa-555 secondary antibodies (Molecular Probes ...
-
bioRxiv - Microbiology 2021Quote: ... and visualized with goat-anti-mouse (PO260, 1:100, Dako) horseradish peroxidase labeled secondary antibody ...
-
bioRxiv - Pathology 2019Quote: ... anti-desmin (1:1000, mouse monoclonal, Dako-Cytomation, Trappes, France) and anti-GAPDH antibody (1:5000 ...
-
bioRxiv - Microbiology 2019Quote: ... A 1:3,000 dilution of goat anti-mouse (Dako, #P0447), anti-rabbit (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, California), rabbit anti-S100β (1:400 ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-PECAM1 monoclonal (clone: JC70A, 1:50, M0823, Dako), mouse anti-CD68 monoclonal (clone ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-PCNA (1:200, M0879, Dako, Agilent, CA, USA), rabbit anti-S100β (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-PCNA (1:200, M0879, Dako, Agilent, CA, USA), rabbit anti-S100β (1:200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated rabbit anti-mouse (Agilent, P0260022-2, 1:3000).
-
bioRxiv - Genetics 2023Quote: ... and anti-mouse HRP-conjugated (1:1000) secondary antibody (Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... Both mouse monoclonal anti-Ki67 CloneMIB-1 (Dako, cat# M7240) and rabbit polyclonal antibody MGP (ProteinTech ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse monoclonal anti-CKAE1/AE3 (Dako, M3515, 1:200 dilution) were added to their respective spheroids and incubated for 2 days at 4 degrees ...