Labshake search
Citations for Agilent :
351 - 400 of 6877 citations for Mouse N Myc Proto Oncogene Protein MYCN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Salmonella typhimurium MsbA (T561C in a C88A/C315A cysteine-less background) with an N-terminal poly-histidine-tag was expressed in BL21-CodonPlus (DE3)-RIPL (Agilent). Expression was induced with 1 mM IPTG for 4 hours at 30°C and membrane proteins were solubilized with 1% DDM and 0.04% sodium cholate in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 500 μl of culture headspace was sampled via gas-tight syringe and subject to gas chromatography through a HayeSep N column (Agilent) at 90°C in N2 carrier gas ...
-
bioRxiv - Biochemistry 2022Quote: ... or a FLAG tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was added on the N-terminus of MBP WT or R919* TRPA1 using Quikchange Lightning site-directed mutagenesis (Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Microbiology 2019Quote: ... Dried FAMES were redissolved in n-hexane and then quantified by gas chromatography (N6890, Agilent Technologies, Santa Clara, CA, USA) and identified with a MIDI Sherlock microbial identification system version 4.5 (MIDI Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT N-terminal point mutants were generated from pCR4 TOPO NOCT (Open Biosystems) and Quikchange site directed mutagenesis PCR (Agilent) to generate NOCT(1-431 ...
-
bioRxiv - Microbiology 2019Quote: ... a BglII restriction site within the linker-sequence separating the N-terminal mCherry-tag from hGBP1 was eliminated in pmCherry-hGBP1 by Quickchange Site Directed Mutagenesis (Agilent) using the oligomer pair pmCherry-hGBP1DBglII-F and -R (Table S9) ...
-
bioRxiv - Developmental Biology 2022Quote: ... GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm, Agilent technologies USA). The injector was set at 220 °C and 1 μL injections were made with helium as carrier gas ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Microbiology 2022Quote: ... The copies of expressed hACE2 or SARS-CoV-2 N gene copies in individual tissues were interpolated based on threshold cycle (Ct) values determined using MxPro qPCR software (Agilent). A value of 1 was assigned if gene copies were below the detection limits.
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Molecular Biology 2023Quote: ... each reaction was diluted with 100μl 2X SSC and slot blotted using Bio-Rad Slot blot apparatus onto Hybond-N+ membranes (Amersham) which were UV crosslinked with autocrosslink settings (120mJ/cm2) of Stratalinker 1800 (Stratagene) apparatus ...
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Plant Biology 2023Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an additional serum-free protein block (DakoCytomation) to reduce nonspecific binding of endogenous proteins ...
-
bioRxiv - Synthetic Biology 2019Quote: ... After blocking with serum-free protein block (Dako), they were incubated with the primary antibodies for 120 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-glial acidic fibrillary protein (GFAP)(Dako), mouse anti-glutamic acid decarboxylase 67 (GAD67 ...
-
bioRxiv - Bioengineering 2020Quote: Proteins were expressed in BL21(DE3)Gold (Stratagene) and purified as described previously6 ...
-
bioRxiv - Biophysics 2021Quote: ... proteins were expressed using BL21(DE3) cells (Agilent). The cells were grown at 37°C until an optical density at 600nm of .6 then induced with 0.2mM isopropyl-Beta-D-thiogalactoside overnight at 18° C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein blocking was performed for 20 min (Dako). NUP210 primary antibody (Atlas ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was overexpressed in BL21(DE3) RIL (Agilent) at 37 °C in Terrific Broth (TB ...
-
bioRxiv - Pathology 2021Quote: ... Slides were placed in a Protein Block (DAKO) for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Protein-Block solution (DAKO Agilent technologies, X0909) respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Protein-Block solution (DAKO Agilent technologies, X0909) respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... blocked in Dako Protein Block (Cat #X0909, Agilent), and stained by secondary antibodies (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... The slides were blocked with protein Block (Agilent) to prevent nonspecific antibody binding ...
-
bioRxiv - Microbiology 2023Quote: ... The slides were blocked with Protein Block (Agilent) to prevent nonspecific antibody binding ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were blocked using 10% protein block (Dako) in PBS containing 0.5% Triton-X-100 for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... then blocked with Dako protein block (Agilent Technologies) for 30 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by protein block (X0909, Dako North America). At room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plates were then incubated at 37°C for 48 hours then analyzed by flow cytometry and ELISA or monitored for target cell death using xCelligence eSight (Agilent Technologies, Inc., Santa Clara, CA).
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Abcam; mouse anti-BrdU, 1:100,BD Biosciences; mouse anti-Nestin, 1:300, Millipore; rabbit anti-GFAP, 1:400, Dako; rabbit anti-Ki67 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... membranes were incubated with 1:200 (v/v) mouse monoclonal anti-AX AO3.2 [16] and 1:2000 (v/v) anti-mouse IgG-HRP (Dako Cytomation) diluted in 1%(w/v ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used for immunoblotting were horseradish peroxidase-coupled goat anti-mouse and goat anti-mouse IgG (Dako, 1:5000). Secondary antibodies used for immunofluorescence were Alexa fluorophore (488 ...
-
bioRxiv - Microbiology 2022Quote: ... mixture and then immuno-stained with an anti-nucleoprotein (NP) mouse mAb followed by horseradish peroxidase-labelled rabbit anti-mouse immunoglobulins (DAKO) as previously described (31) ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL of either mouse anti-human LAIR-1 (clone Dx26; purified in house) or mouse isotype control IgG1 (Dako) diluted in PBS+1% BSA buffer were incubated overnight at 4°C ...