Labshake search
Citations for Agilent :
101 - 150 of 6368 citations for Mouse Angiotensin III Ang III CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: Target cDNAs were measured by quantitative PCR with Brilliant III Ultra-Fast SYBR Green qPCR master mix (Agilent) using a Lightcycler 480 qPCR machine (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ~20 nl/min ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Aria Mx real time PCR system with the Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies) was used to quantify the transcript levels ...
-
bioRxiv - Neuroscience 2020Quote: ... 5–20 ms at 0.5 Hz) controlled by a Picrospritzer III (General Valve) and a pulse generator (Agilent). During the surgical procedure ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were performed in duplicate using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) on a C1000 Touch™ thermo Cycler using the CFX96™ Real-Time System (BioRAD) ...
-
bioRxiv - Physiology 2020Quote: ... All qPCR reactions used SYBR® Brilliant III Ultra-Fast QBRR Green Prime Mix Low ROX (Agilent Technologies). Beta Actin was used as an endogenous control ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR was undertaken following the Brilliant III Ultra Fast SYBR QPCR Master Mix protocol (Agilent Technologies, 600882) and results were analysed with MxPro v4.10 ...
-
bioRxiv - Genetics 2022Quote: ... Proestrus and Estrus samples were run on an AriaMx qPCR with Brilliant III Ultra-Fast master mix (Agilent). 7.5dpc and decidual cell lines were analyzed with TaqMan Gene Expression master mix (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 5–20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The speed of injection was ∼0.1 μl/10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA levels were measured by quantitative realtime PCR using Brilliant III Ultra-Fast SYBR Green qPCR mix (Agilent) and 24 ng of cDNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The qPCR reaction mixture consisted of 1X Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent), 0.002X reference dye (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... Phosphopeptide enrichment was performed on 5 µL phase Fe(III)– NTA cartridges on an AssayMAP Bravo platform (Agilent) following the immobilized metal affinity chromatography protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 10-µl reactions were prepared with the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent) in technical duplicates for each sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was amplified using the Brilliant III ultra-fast SYBR Green QPCR Master Mix® (Agilent©, #600882) in a 20 µL final volume in 96-well PCR optical plates (Axygen®) ...
-
bioRxiv - Plant Biology 2022Quote: ... qPCR was performed using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, US) following its instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR reactions were performed in duplicate using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) on a C1000 Touch™ thermo Cycler using the CFX96™ Real-Time System (BioRAD ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Immunology 2022Quote: ... Each assay was run in triplicate using 15µl of reaction mix containing 7.5ul Brilliant III Ultra-Fast SYBR Green (Agilent Technologies), 500nM forward and reverse primers and 5µl of cDNA (2.5ng of total reverse-transcribed RNA) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies #600886) according to manufacturer’s protocol with 5 ng RNA in 10 µl reactions using 0.5 µM of each primer (Supplementary file 4) ...
-
bioRxiv - Microbiology 2022Quote: ... The quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... Reactions were performed in a 25 μl reaction mix comprising 1X Taqman Brilliant III master mix (Agilent, Stockport, UK), 0.2 pmol/μl forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions contained 10 µL of 2× Brilliant III Ultra-Fast SYBR green QPCR master mix (catalog no. 600882; Agilent), 2 µL each of 2 µM PCR primers (see Table S1 for used primers) ...
-
bioRxiv - Cell Biology 2023Quote: ... or directly processed by RT-qPCR using Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent Technologies), using primers designed with SnapGene® (version 6.1.1 ...
-
bioRxiv - Systems Biology 2024Quote: ... The qPCR reactions were performed with the Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies, USA) on the Roche LightCycler480 PCR system (1 min 95 °C ...
-
bioRxiv - Genetics 2023Quote: ... Transcript levels were quantified by qPCR using the Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies) on a Roche LightCycler 96 Instrument ...
-
bioRxiv - Cell Biology 2019Quote: ... was then performed with SYBR Green 2x Master Mix (Applied Biosciences) or Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent) utilizing the EPA1qPCR F and EPA1qPCR R primer set to amplify the EPA1 amplicon ...
-
bioRxiv - Genetics 2020Quote: ... Each reaction were carried out in technical triplicates with Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent) on the LightCycler 480 Instrument (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1.2μL each of forward and reverse primer along with 0.6μL of PCR water and 5μL Brilliant Sybr Green III qPCR master mix (Agilent Technologies; Cat# 600882). qPCR was carried out at CFX96 Touch System (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: ... Each qPCR reaction was prepared following manufacturer’s recommendations and composed of 7.5 μl Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies), 0.3 µl of provided reference dye (freshly diluted 1:50 in PCR-grade water ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was carried out in a 20 μl reaction volume containing 10 μl Brilliant III SYBR Green Master Mix (Agilent), 500 nM of primers ...
-
bioRxiv - Microbiology 2019Quote: ... The relative expression levels of targeted genes were measured by qRT PCR using Brilliant III ultra-fast SYBR green QPCR mix (Stratagene) in an Applied Biosystems 7500 Real-Time PCR system ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative real-time PCR (qPCR) was assayed in 10 μl reactions with Brillant III Ultra Fast SYBR-Green Mix (Agilent) using a Stratagene MX3005p system ...
-
bioRxiv - Immunology 2021Quote: ... qPCR was performed on a Roche LightCycler 480 using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) and Qiagen Quantitect primers (Hs_ACTB_1_SG ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... qRT–PCR reactions were performed in duplicate using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) on a C1000 Touch™ thermos Cycler CFX96™ Real-Time System (BioRAD ...
-
bioRxiv - Neuroscience 2021Quote: ... were used to amplify mbp transcripts within a qPCR reaction (Brilliant III Ultra-fast SYBR Green qPCR Master Mix, Agilent). Transcript levels were detected using Roche Light Cycler 96 (Roche Life Science ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was done using the Brilliant III Ultra-Fast SYBR® Green Master mix (Agilent Technologies, Santa Clara, CA) in an AriaMx (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μl Brilliant III Ultra-Fast SYBR® Green Low ROX qPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA) and 0.8 μl of each primer (10 μM) ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 384-well plates on 5 μL scale reactions using 2 μL diluted cDNAs and Brilliant III Ultra-fast SYBR Green qPCR Master Mix (Agilent) with primers listed in Table S7 at a final concentration of 0.4 μM ...
-
bioRxiv - Microbiology 2021Quote: ... was determined by qPCR using Mtb16s rRNA gene and Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... The qRT-PCR reaction was made using the Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... In case of ELF1α amplification was carried out in a 15 μL reaction volume containing 7.5 μL of 2X Brilliant III Ultra-Fast SYBR® Green QRT-PCR Master Mix (Stratagene), 0.75 μL of each forward and reverse primers (0.5 μM) ...
-
bioRxiv - Genetics 2020Quote: Quantitative RT-PCR was performed on MYB5a and MYB5b using SYBR-Green Brilliant III Ultra-Fast reagents (Agilent Technologies, USA), in optical 96-well plates (Greiner Bio-One ...
-
bioRxiv - Plant Biology 2022Quote: ... using the Brilliant III Ultra-fast SYBR® Green QPCR Master mix with low ROX (Agilent, Santa Clara, CA, USA). Amplifications were performed in duplicate from the five biological samples ...
-
bioRxiv - Molecular Biology 2022Quote: 1 µL of ChIP eluate was used for quantitative real-time PCR (qPCR) in 10 μl reactions with Brillant III Ultra Fast SYBR-Green Mix (Agilent) using a Stratagene MX3005p system ...
-
bioRxiv - Microbiology 2022Quote: ... HSV-1 genome copy number was determined in 50ng of extracted DNA by qPCR as previously described (5,29) using Brilliant III SYBR ® Green Master Mix with ROX (Agilent); and analysis was performed using QuantStudio(tm ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gene-specific primers were used (Table S1) together with Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies), following the manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... FCCP (mitochondrial uncoupler) and antimycin A with rotenone (complex III and I inhibitors, respectively) were loaded into sensor cartridge injection ports (Agilent) to yield final concentrations of 2 μM oligomycin A ...
-
bioRxiv - Plant Biology 2024Quote: ... The synthesized cDNA was subsequently used as template for quantitative real time PCR based analysis of the expression levels of the target genes using Brilliant III Ultra-Fast SYBR QPCR MM (Agilent) in conjunction with Rotor-Gene® Q (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: Genes of interest were amplified and analysed via qPCR using Brilliant III SYBR® Green qPCR master mix (Agilent, 600882) on the MX3000p qPCR detection system (Stratagene ...