Labshake search
Citations for Agilent :
51 - 100 of 7112 citations for Mouse 14 3 3 protein sigma SFN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free HSF2BP protein as well as the complex between ARM and F15X were analyzed using a Bio SEC-3 column (Agilent) equilibrated in 25 mM Tris-HCl buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 drops per slide of secondary antibody (EnVision + labeled polymer-HRP anti-mouse, Dako K4001, or anti-rabbit, Dako K4003) were added and incubated for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 drops per slide of secondary antibody (EnVision + labeled polymer-HRP anti-mouse, Dako K4001, or anti-rabbit, Dako K4003) were added and incubated for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... For signal detection the MACH 3 Mouse HRP Polymer Detection system was employed according to manufacturer’s protocol using DAB+ (Fa.Agilent Technologies, K3468). Slides were counter-stained with Hematoxylin Gill’s Formula (Fa.Vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA quality was confirmed as RIN 3 7.5 via Bioanalyzer RNA 6000 Pico kit (Agilent, 5067-1514) and RNA was quantified via Qubit RNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... using the Multiple Affinity Removal Column Human 14 (MARS 14, Agilent) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by another containing 3 μM BPTES (all XFp Mito Fuel Flex Test Kit, Agilent Technologies, 103270-100) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’mitoUTR was cloned into the TFAM-mScarlet/pWPXL or the 3’mitoUTR_TFAM-mScarlet_pWPXL plasmid using megaprimers following the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) large insertion protocol provided by the manufacturer ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by incubation with 3% hydrogen peroxide to quench endogenous peroxidase activity and 15 minutes in serum-free protein block (DAKO, Glostrup, Denmark). Sections were then subjected to appropriate antigen retrieval methods (if needed ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Genetics 2019Quote: ... 3 μg of purified RNA were converted into cDNA via the Affinity Script QPCR cDNA synthesis kit (Agilent Technologies). cDNA synthesized without the RT/RNase block enzyme mixture was utilized as a control for genomic DNA contamination ...
-
bioRxiv - Microbiology 2019Quote: ... 3 µg of purified RNA were converted into cDNA via the Affinity Script QPCR cDNA synthesis kit (Agilent Technologies) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
The MKK3 MAPK cascade integrates temperature and after-ripening signals to modulate seed germinationbioRxiv - Plant Biology 2024Quote: ... Cyanine 3-labelled cRNA was synthesized from 150 ng RNA using the Low Input Quick Amp Labeling Kit (Agilent) and predicated using RNeasy Mini Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... Specific point mutations in Hmga1 3’UTRs (shown in Fig 3A) cloned into pRL-CMV vector were generated using site-directed mutagenesis kit (Stratagene). In addition ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Microbiology 2022Quote: All of the indicated mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) (66) ...