Labshake search
Citations for Agilent :
201 - 250 of 4198 citations for Leucine Rich Repeats And Immunoglobulin Like Domains Protein 1 LRIG1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Ki67 (1:1000) and glial fibrillary acidic protein (GFAP) (1:1500) from Dako Cytomation (Glostrup ...
-
bioRxiv - Microbiology 2021Quote: ... Subsequent antibody incubation was performed at 4°C overnight or for one hour at room temperature using Dako polyclonal goat anti-rabbit or anti-mouse immunoglobulins/HRP (Agilent Technologies, USA). Membranes were washed using 0.1% TBS-T and proteins were detected using ECL or ECL Select (GE Healthcare ...
-
bioRxiv - Physiology 2022Quote: ... Immunologic), the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Systems Biology 2021Quote: ... The relative secreted expression of ARTN was determined by western blotting of culture supernatants using the rabbit antibody HPRK3140989 from the Human Protein Atlas and an HRP-conjugated swine anti-rabbit antibody (p039901-2, Dako) combined with Immobilon Western Chemiluminescent HRP Substrate (Millipore) ...
-
bioRxiv - Systems Biology 2021Quote: ... rabbit anti-THBS4 (antibody HPRK2400008 kindly provided from the Human Protein Atlas) as primary antibody and a HRP-conjugated swine anti-rabbit antibody (p039901-2, Dako) combined with TMB substrate (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... GST and GST-fused CBS-pair domain of murine CNNM2 were expressed in transformed BL21 (DE3) cells (Stratagene, CA). Bacterial cells were lysed by sonication in ice-cold PBS containing 1% Triton X-100 and protease inhibitor phenylmethylsulfonyl fluoride (Sigma–Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were detected using biotinylated IgG secondary antibodies (Agilent, 1:400), using streptavidin-HRP (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... The anti-CD8 antibody (1:5,000, C8/144B, mouse monoclonal antibody, Agilent) was detected using the Opal 520 fluorophore (1:150 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies were detected using biotinylated IgG secondary antibodies (Agilent, 1:400), using streptavidin-HRP (Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... glial fibrillary acidic protein (GFAP) staining was performed (rabbit-anti-GFAP primary antibody, DAKO Z0334 ...
-
bioRxiv - Pathology 2023Quote: ... In addition to blocking unspecific antibody binding using Serum-Free Protein Block (X0909, Agilent) for 10 minutes ...
-
bioRxiv - Immunology 2023Quote: ... and rabbit polyclonal antibodies against CD-3 protein (Dako, Glostrup, Denmark; cat. no. A0452).
-
bioRxiv - Microbiology 2019Quote: ... The immunohistochemical staining was revealed with a biotinylated polyclonal goat anti-mouse Immunoglobulins conjugated with horseradish peroxidase (HRP) (Dako, LSAB2 system-HRP, K0675) and the diaminobenzidine HRP chromagen (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the sections were rinsed with PBST and incubated in a peroxidase-labeled polymer conjugated with goat anti-mouse immunoglobulin (Dako Envision Plus, Dako, Carpinteria, CA, USA) for 30 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... The immunohistochemical staining was revealed with a biotinylated polyclonal goat anti-mouse immunoglobulin conjugated with horseradish peroxidase (HRP; Dako, LSAB2 system-HRP, K0675) and the diaminobenzidine HRP chromogen (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Slides were rinsed in PBS and developed using polyclonal goat anti-rabbit Immunoglobulins conjugated with horseradish peroxidase (HRP, Agilent Dako, Santa Clara, CA) as a secondary antibody ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Slides were rinsed in PBS and developed using polyclonal goat anti-rabbit Immunoglobulins conjugated with horseradish peroxidase (HRP, Agilent Dako, Santa Clara, CA) as a secondary antibody ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Primary anti-CD31 antibody in Tris-HCl buffer containing stabilizing protein and 0.015 mol/L sodium azide (Dako Antibody Diluent, Dako, Glostrup, Denmark) were then added to the slides ...
-
bioRxiv - Bioengineering 2021Quote: ... and Iba-1 (ionized calcium binding adaptor protein, 1:5000, Dako, Cat#019-19741). Mouse anti-SARS-CoV-2 N monoclonal antibody (1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-glial fibrillary acidic protein (GFAP, 1:1,000, DAKO), mouse anti-4A4 (1:2,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... glial fibrillary acidic protein (GFAP) diluted 1:2000 (Dako, Z0334), PDGFRA diluted 1:200 (Cell Signaling ...
-
bioRxiv - Neuroscience 2022Quote: ... Glial Fibrillary Acidic Protein (GFAP, rabbit, 1:300, Dako, Z0334); Ionized calcium-binding adapter molecule 1 (Iba1 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit glial fibrillary acidic protein GFAP (DAKO, ZO334, 1:1000), chicken GFP (Abcam ...
-
bioRxiv - Genetics 2021Quote: ... glial fibrillary acidic protein (GFAP; polyclonal 1:1000, ZO334, DAKO-Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... and Glial fibrillary acidic protein (GFAP, 1:1000, Dako, G9269). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-rabbit glial fibrillary acidic protein (GFAP) (1:1000, Dako), and anti-mouse S100β (1:200 ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRP conjugated secondary antibodies (Dako, 1:5000) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... polyclonal anti-tau antibody (Dako, 1/500), monoclonal anti-alpha-synuclein (LB509 ...
-
bioRxiv - Cell Biology 2021Quote: ... diluted 1:300 in Antibody Diluent (Dako) was used ...
-
bioRxiv - Cell Biology 2021Quote: ... diluted 1:200 in Antibody Diluent (Dako) was used ...
-
bioRxiv - Neuroscience 2022Quote: ... antibody (1:1000 in Dako diluent buffer) for 15 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted 1:500 in antibody diluent (Dako). Slides were washed with PBS then incubated with biotinylated secondary antibody (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... and Ile-residues of the HXXXDX motif of ZmGL2 and ZmGL2-LIKE were generated using QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The ZmGL2 protein was also expressed in E ...
-
bioRxiv - Biophysics 2019Quote: Human CAMSAP1 residues 1474-1613 encompassing the CKK domain (HsCKK) were cloned into pET28a vector and expressed in BL21(DE3) cells (Stratagene). Following purification via immobilized metal-affinity chromatography (IMAC ...
-
bioRxiv - Immunology 2019Quote: ... mutant with Cys20 to Arg and Cys23 to Ser mutations in the RING1 domain was made by site-directed mutagenesis using Quickchange (Stratagene) with primers CCGCTGGTGTCTAGAAAGCTCAGTCTTGGGGAGTAC and GTACTCCCCAAGACTGAGCTTTCTAGACACCAGCGG ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene) using the primer sequences ...
-
bioRxiv - Cell Biology 2020Quote: ... The cytoplasmic and KASH domains of the mini-nesprin constructs were obtained from a previous publication.22 The mutant domain was made from this construct by site-directed mutagenesis (Quikchange II XL, Agilent). The DN-KASH construct was made by ligation after digestion by ClaI of a PCR product from the mini-nesprin construct ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Biophysics 2020Quote: The deletion construct containing the catalytic domain and the interdomain linker (CreCat, residues 127-343) was prepared using QuikChange Site-Directed Mutagenesis Kit (Agilent) from a pET21A vector (Novagen ...
-
bioRxiv - Biochemistry 2019Quote: Mutants were generated for each domain by introducing single point mutations using the Quick change site-directed mutagenesis kit (Stratagene). The primer sequences used for mutagenesis are listed in the supplementary S1 Table ...
-
bioRxiv - Genetics 2021Quote: ... while the domain deletions were constructs from initial cDNA constructs using the site-directed mutagenesis kit QuikChange™ (Agilent Technologies) and adequate primers (Supplemental Table S4) ...
-
bioRxiv - Cell Biology 2020Quote: ... including glutathione S-transferase (GST)-NEPH1 cytoplasmic domain (CD) and GST-NEPHRIN CD were expressed and purified from Escherichia coli BL21 cells (Stratagene). Purified phosphorylated GST-NEPH1 was expressed and purified from TKB1 cells (Stratagene) ...
-
bioRxiv - Biochemistry 2021Quote: ... The kinase domain c-Abl mutations were introduced into the human c-Abl kinase domain by site-directed mutagenesis using the QuikChange II kit (Agilent) and verified by DNA sequencing.
-
bioRxiv - Cancer Biology 2021Quote: ... first an AgeI cut-site was knocked into the pcDNA3.1-Myoferlin-HA plasmid immediately prior to the transmembrane domain by site-directed mutagenesis (Agilent: 210518). Second ...
-
bioRxiv - Genomics 2020Quote: ... The indicated domain deletions and point mutations were generated by site-directed mutagenesis using the QuickChange Lightning Site-Directed Mutagenesis kit (Agilent). For CD34+ HSPC cultures ...
-
bioRxiv - Biophysics 2023Quote: Yeast eIF4G was purified as described previously.46 A pTYB2 vector encoding a C-terminal fusion of eIF4G with an intein and chitin-binding domain was transformed into BL21 CodonPlus RIL cells (Agilent). Protein expression was induced with 0.5 mM IPTG for overnight at 16 °C ...
-
bioRxiv - Immunology 2023Quote: ... in the α3 domain of HLA-A*02:01 described to abrogate binding of CD8 (13) were changed by site-directed mutagenesis (Agilent).
-
bioRxiv - Genetics 2023Quote: ... and the point mutations in the PWWP domain of DNMT3B (W263A, D266A, S270P, K276E and K294E) were introduced using the QuikChange II site-directed mutagenesis kit (Agilent). DNMT3BΔN starts from M200 and was generated by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Slides were incubated with primary antibodies for pan-cytokeratin antibody (1:100, Dako) and BRCA1 (antibody validation described previously ...