Labshake search
Citations for Agilent :
401 - 450 of 1340 citations for L Alanine N T Boc 2 13C 98 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Cell Biology 2019Quote: ... and treated with 2% proteinase K (Dako) in Tris-HCl buffer solution (pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (Seahorse®, Agilent) in a CO2 free incubator for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Bluing buffer (Agilent Technologies; Cat # CS703230-2) was then added to the slide until the sections were completely covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Biophysics 2020Quote: ... rabbit polyclonal anti-tau (Agilent, A002401-2) at a 1:3000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3E: Rabbit anti-GFAP (DAKO, Z033401-2); Fig ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM glutamine (Agilent Technologies, 103579-100), and 10 mM glucose (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli SURE 2 Supercompetent cells (Stratagene, USA) for clonal selection and amplification ...
-
bioRxiv - Neuroscience 2019Quote: ... (2) testing the insert size (Agilent 2100); (10 ...
-
bioRxiv - Genomics 2020Quote: ... and FISH Wash Buffer 2 (Agilent, G9402A) at room temperature for 1 min ...
-
bioRxiv - Molecular Biology 2020Quote: The yeast strain YRG-2 (Stratagene, USA) containing the HIS3 and lacZ reporter genes was used to test transcriptional activation activity ...
-
bioRxiv - Physiology 2021Quote: ... with hematoxylin counter stain (Agilent, S330130-2) was used to visualize positive stain ...
-
bioRxiv - Cell Biology 2020Quote: ... Guinea Pig anti-Insulin (Dako IR00261-2) and mouse anti-TAF4 (TAF II p135 ...
-
bioRxiv - Genomics 2021Quote: ... and bluing buffer (Dako, cat.no.: CS70230-2) followed by Eosin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-mouse HRP secondary (DAKO K400111-2), OPAL TSA 520 (Akoya # FP1487001KT) ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mM glutamine (Agilent, 103579-100), and 10 μM HLM006474 or DMSO (vehicle ...
-
bioRxiv - Neuroscience 2022Quote: ... in antibody diluent (Dako, Cat# S080983-2). Sections were rinsed with PBS (3x 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Physiology 2022Quote: ... in antibody diluent (Agilent, cat#S080983-2) overnight at 4°C ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... anti-mouse (Dako P044701-2; 1:1000) Alexa Fluor 488 or anti-rabbit (#1706515 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2) the pBluescript II SK (-) vector (Agilent) following EcoRV digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-PALB2 full-length and fragments were purified from 1 L of ArcticExpress cells (Agilent Technologies), grown at 37°C in LB broth medium containing 50 µg/mL ampicillin and 25 µg/mL gentamycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... all cell lines were plated on a poly-L-lysine coated 96-well Seahorse plates (Agilent) at 10 x 103 cells/well ...
-
bioRxiv - Cell Biology 2022Quote: ... After 16 h of stress in low glucose growth medium (1 g/L; Agilent Technologies, 103577), cells were washed once with PBS ...
-
bioRxiv - Neuroscience 2020Quote: Specimens were formalin-fixed at time of collection and then agarose-gel-embedded (Fig. S2B) before being examined using a 4.7-T Agilent MR scanner (Agilent Technologies, Santa Clara, CA) with a home-made circular surface coil (1.5-cm diameter ...
-
bioRxiv - Immunology 2020Quote: ... The processed T cell samples were pooled and quantified relatively utilizing capillary electrophoresis time-of-flight mass spectrometry (CE-TOF-MS, Agilent Technologies, Waldbronn, Germany) with analysis performed by Human Metabolome Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were harvested from the T-75 flasks and seeded into a Seahorse 96-well XF Cell Culture microplate (Agilent Seahorse Bioscience, CA, USA) in 80 µL of the culture medium at a density of 20,000/well ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange® Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... variants of CaMKII with N-terminal His6-SUMO tag were co-expressed with λ phosphatase in Escherichia coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) in LB medium at 16 □ for 24 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and G73A Sco-CHH-L) was performed using the QuikChange PCR-mediated Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer's instruction with the plasmid pET-22b(+)-Sco-CHH-L encoding the wild-type Sco-CHH-L (24 ...
-
bioRxiv - Plant Biology 2019Quote: ... 20 µl of sample injected and separated on a Zorbax SB-C18 column (1.8-µm, 2.1×1.8mm; Agilent) connected to a Zorbax SB-C18 analytical guard column (5-µm ...
-
bioRxiv - Microbiology 2022Quote: ... External calibration was performed prior to data collection using ESI-L Low Concentration Tuning Mix (Agilent Technologies), with hexakis(1H,1H,2H-perfluoroethoxy)phosphazene employed as internal lock-mass calibrant throughout the run ...
-
bioRxiv - Neuroscience 2022Quote: N2A cells were plated (12.500 cells/well) on poly-l-lysine-coated XF24 wells plates (Seahorse Bioscience) in DMEM (high glucose ...
-
bioRxiv - Systems Biology 2024Quote: ... the MS was calibrated using the ESI-L Low Concentration Tuning Mix (Agilent, Santa Clara, CA, USA). The ESI-L Low Concentration Tuning Mix (diluted 1:4 [v/v] with 75% ACN ...
-
bioRxiv - Microbiology 2023Quote: ... . All the acquired mass spectra were internally calibrated by injecting ESI-L Low Concentration Tuning Mix (Agilent Technologies Netherlands BV ...