Labshake search
Citations for Agilent :
101 - 150 of 1837 citations for Integrin beta 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Sialyl-Lewis a (sLea) and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Molecular Biology 2023Quote: ... slides were washed and incubated with the corresponding secondary antibodies when needed (rabbit anti mouse, Abcam; rabbit anti rat, Vector; Goat anti-rabbit, Dako) and visualization systems (Bond Polymer Refine Detection ...
-
bioRxiv - Biochemistry 2023Quote: ... Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP (Goat Anti-Rabbit) (P0448, Agilent Dako) (dilution ...
-
bioRxiv - Biochemistry 2023Quote: ... Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP (Goat Anti-Rabbit) (P0448, Agilent Dako) (dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... and recombinant adenovirus particles were produced following the AdEasy XL Adenoviral Vector System protocol (#240010 Agilent Technologies). Islets were transduced using a microfluidic device to obtain uniform infection of the islet cells throughout the islet volume and were incubated overnight before imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-CD3 (DAKO); rabbit anti-IgG (R&D) ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-hrGFP (Stratagene), rat anti CD9 (KMC8 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti GFAP (Dako, product no ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-Plyz (Dako), rat anti-RFP (Chromotek) ...
-
bioRxiv - Pathology 2020Quote: ... rabbit α-GFAP (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... or EnVision rabbit (Dako) with NOVAred substrate (Vector) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or anti-rabbit (Dako) HRP-conjugated secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-GFAP (rabbit, Dako, catalog #z0334 ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD3 (Rabbit polyclonal, Dako) at 1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Rabbit/Mouse (Dako, Denmark).
-
bioRxiv - Pathology 2023Quote: ... rabbit anti-FITC (Dako) and Brightvision goat anti-rabbit HRP (Immunologic ...
-
bioRxiv - Neuroscience 2023Quote: ... or rabbit (DAKO; P0448) HRP at 1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... CD117 (rabbit polyclonal, Dako), or glycophorin A (rabbit monoclonal ...
-
bioRxiv - Pathology 2023Quote: ... rabbit immunoglobulin (Dako/Agilent), or anti-sheep secondary antibodies (Jackson ImmunoResearch Inc ...
-
bioRxiv - Pathology 2023Quote: ... rabbit immunoglobulin (Dako/Agilent), or anti-sheep secondary antibodies (Jackson ImmunoResearch Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100β (DakoCytomation) at 1:750 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Rabbit Envision (Agilent, K4003). The sections were rinsed with wash buffer and visualised using DAB with the Intense R kit.
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated with horseradish peroxidase-conjugated rabbit anti-goat or swine anti-rabbit or rabbit anti-mouse antibodies (Dako, Agilent Technologies) and incubated at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... or polyclonal rabbit anti-rabbit immunoglobulins/HRP (Dako: Code no. P0448, 1:2000) at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were washed with phosphate-buffered saline (PBS) then incubated with horseradish peroxidase-conjugated rabbit anti-goat or swine anti-rabbit or rabbit anti-mouse antibodies (Dako, Agilent Technologies) and incubated at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... The pST39-BLOC-1 plasmid encoding recombinant BLOC-1 was transformed into BL21gold(DE3)plysS cells (230134, Agilent). Several colonies from the plate were inoculated into a starter culture of 10 ml LB supplemented with 34 μg/ml chloramphenicol and 100 μg/ml ampicillin that was grown overnight at 37 °C with moderate shaking ...
-
bioRxiv - Cell Biology 2021Quote: All recombinant proteins were expressed in either BL21-CodonPlus (DE3)-RIPL or ArcticExpress (DE3) competent cells (Agilent Technologies) grown in LB medium overnight at 13-16°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins (GST, GST-BZR1, GST-PIF3 and GST-H2A) expressed in BL21- CodonPlus (DE3)-RIL (Agilent Technologies) were purified using glutathione beads ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant adeno-associated viruses (AAVs) with serotype 8 were produced using the AAV helper-free system (Agilent Technologies). Human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Biochemistry 2022Quote: ... goat anti-rabbit and rabbit anti-goat secondary antibodies conjugated to HRP (Dako-Agilent) were used at a dilution of 1:7000 ...
-
bioRxiv - Biochemistry 2022Quote: ... goat anti-rabbit and rabbit anti-goat secondary antibodies conjugated to HRP (Dako-Agilent) were used at a dilution of 1:7000 ...
-
bioRxiv - Neuroscience 2021Quote: ... polyclonal rabbit anti-mouse IgG biotinylated and polyclonal goat anti-rabbit IgG biotinylated (Dako) (IHC ...
-
bioRxiv - Microbiology 2019Quote: ... Secondary antibodies HRP-conjugated rabbit anti-mouse and swine anti-rabbit (Dako Cytomation, DK) were used at a 1:10’000 dilution.
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies (rabbit anti-AQP4, 1:500, MerckMillipore; rabbit anti-GFAP, 1:500, Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Goat Anti-Rabbit and Rabbit Anti-Mouse horseradish peroxidase-(HRP) conjugated secondary antibodies (Dako) were used in our experiments.
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...