Labshake search
Citations for Agilent :
351 - 400 of 2123 citations for Integrin alpha 5 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... swine anti-rabbit 1:200 (eo353 Dako) for CD68 or goat anti-rat 1:200 (STAR80B Serotec ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-Tau (Dako, A0024, 1:1000), guinea pig anti-NeuN (Millipore ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-GFAP (1:500; DAKO, Z0334), rat anti-CTIP2 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (DAKO, #Z0334, 1:500), and mCherry Monoclonal Antibody (16D7 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit-anti-GFAP (DakoCytomation, Z0334; 1:1000); Mouse IgG1κ-anti-S100β (Sigma-Aldrich ...
-
bioRxiv - Pathology 2023Quote: ... Envision mouse/rabbit HRP (DAKO, Glostrup, Denmark) was used in the secondary detection step ...
-
bioRxiv - Neuroscience 2023Quote: ... GFAP (Rabbit, 1:500; Z0334, Agilent DAKO), VGluT1 (Guinea pig ...
-
bioRxiv - Microbiology 2023Quote: ... and rabbit anti-goat Ig/HRP (Agilent) for IAV) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A rabbit anti-goat antibody (Agilent, # E0466) was used as secondary antibody ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-vWF (Dako, #A0082, 1:1000), rabbit anti-Cleaved Caspase-3 (Cell Signaling ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit/Mouse (Agilent, Santa Clara, California, USA), and counterstained using haemalum ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-S100β (1:500, Dako, #Z0311) and rabbit anti-Sox2 (kind gift from T ...
-
bioRxiv - Neuroscience 2023Quote: ... GFAP (Rabbit, 1:500; Z0334, Agilent DAKO), VGluT1 (Guinea pig ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti GFAP (1:500; Dako) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:200, DakoCytomation, USA), or rabbit anti-S100β (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-rabbit (P044801, Agilent, 1:2000) immunoglobulins/ HRP for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-rabbit (diluted 1:5000) (Dako, P0217) and anti-rat (diluted 1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:1000; Z0334, Dako), goat anti-Sox9 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (DAKO, #Z0334, 1:2000), and mouse anti-C3 (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:1000, Z0334, Dako), rabbit anti-cleaved caspase-3 (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:4000, Dako, Z0334) or goat anti-DCX (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (Z0334, Dako, 1:1000), goat anti-RSPO1 (AF3474 ...
-
bioRxiv - Pathology 2023Quote: ... rat and rabbit were obtained from DAKO. The secondary antibodies used for immunofluorescence ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-human C3d (1:200; Dako), and rabbit anti-human C5b-9 (1:200 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP-coupled anti-rabbit IgG (DakoCytomation, #P0448), HRP-Streptavidin (PerkinElmer ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP 1:1000 (Dako, M0761) or rabbit anti-Iba-1 1:500 (Wako ...
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit anti-GFAP (1:500, Dako) overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000, DakoCytomation, #z0334), rabbit anti-MAP2 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... or goat anti-rabbit-HRP (Dako, P0448)] diluted 1:10,000 in 1% (w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... HRP-conjugated rabbit/mouse secondary antibody (Agilent) was used ...
-
bioRxiv - Genetics 2024Quote: Recombinant adenoviruses expressing mouse SAR1A or SAR1B were constructed using pAdTrack-CMV and the AdEasy adenoviral vector system (Agilent Technologies, Lexington MA). Adenoviruses were amplified in Ad293 cells and purified using CsCl gradient ultracentrifugation ...
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were resuspended in 5% formic acid/5% acetonitrile and fractionated over a ZORBAX extended C18 column (Agilent, 5μm particles ...
-
bioRxiv - Microbiology 2019Quote: ... 1% acetonitrile/0.5% formic acid was used as eluent for 5 minutes to trap and desalt the peptides on the enrichment column (Zorbax SB C18, 0.3 × 5 mm, Agilent). An acetonitrile/0.1% formic acid gradient from 5% to 40% acetonitrile was then used within 120 minutes to separate the peptides on a Zorbax 300 SB C18 ...
-
bioRxiv - Cell Biology 2021Quote: Secondary antibodies used were Polyclonal Goat Anti-Rabbit or Polyclonal Rabbit Anti-Mouse (1:1000) HRP-conjugated (Dako Agilent), or IRDye® 680RD (1:20,000)- or 800CW (1:10,000)-conjugated for quantitative fluorescence measurements on an Odyssey® Fc Dual-Mode Imaging System (LICOR Biosciences) ...
-
bioRxiv - Cell Biology 2021Quote: Secondary antibodies used were Polyclonal Goat Anti-Rabbit or Polyclonal Rabbit Anti-Mouse (1:1000) HRP-conjugated (Dako Agilent), or IRDye® 680RD (1:20,000)- or 800CW (1:10,000)-conjugated for quantitative fluorescence measurements on an Odyssey® Fc Dual-Mode Imaging System (LICOR Biosciences) ...
-
bioRxiv - Cell Biology 2022Quote: ... The secondary antibodies used were goat anti-rabbit and rat anti-rabbit IgG-HRP (Dako, Santa Clara, CA, USA). Proteins were detected by chemiluminescence using the Clarity™ Western ECL Substrate coupled to a ChemiDoc XRS+(Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant transfer vector was linearized by PmeI and transformed into electro-competent E.coli strain BJ5183-AD-1 (Stratagene, Cat. No. 200157-11) for in vivo recombination with pAdEasy vector ...
-
bioRxiv - Microbiology 2023Quote: ... Sequence encoding the 96-120 NS2B residues was removed from recombinant pTrcHisA plasmid by PCR based site directed mutagenesis [40] using Pfu ultra II fusion HS DNA polymerase (Agilent, Santa Clara, USA) to generate recombinant plasmids expressing N-terminal hexahistidine tag fused active NS2B(H)-NS3(pro ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Microbiology 2020Quote: FITC-conjugated rabbit F(ab’)2 anti-human C1q was obtained by digestion of FITC-conjugated rabbit anti-human C1q (Dako) using 1 U/ µg of recombinant His-tagged IdeS protease ...
-
bioRxiv - Cancer Biology 2021Quote: ... the specimens were detected by incubating with goat anti-rabbit or anti-rabbit/mouse IgG-HRP for 1 h and subsequently with DAB (Dako). The tissue sections were then counterstained with 0.1% (wt/vol ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Systems Biology 2021Quote: ... The relative secreted expression of ARTN was determined by western blotting of culture supernatants using the rabbit antibody HPRK3140989 from the Human Protein Atlas and an HRP-conjugated swine anti-rabbit antibody (p039901-2, Dako) combined with Immobilon Western Chemiluminescent HRP Substrate (Millipore) ...
-
bioRxiv - Cell Biology 2021Quote: ... Secondary antibodies were as follows: polyclonal rabbit anti-goat Immunoglobulins/HRP (P0160) and polyclonal swine anti-rabbit Immunoglobulins/HRP (P0217) were from Dako, DK ...
-
bioRxiv - Pathology 2022Quote: ... appropriate HRP-coupled secondary antibodies (rabbit anti-mouse, Cat. No. P0260, and goat anti-rabbit, Cat. No. P0448, from DAKO and rabbit anti-goat ...