Labshake search
Citations for Agilent :
651 - 700 of 2123 citations for Integrin alpha 5 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... and with secondary goat anti-rabbit (for polyclonal Ab) or rabbit anti-mouse (for monoclonal Ab) IgG HRP-conjugated Ab (1:2000, Dako A/S, Glostrup, Denmark). Signals were visualized by Immobilon Western Chemiluminescent HRP Substrate (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... Ionized calcium-binding adaptor (IBA1, rabbit polyclonal, catalog number 019-19741; Wako, Richmond, VA) or myeloperoxidase (MPO, rabbit polyclonal, catalog A0398, Agilent Dako, Santa Clara, CA) diluted in normal goat serum (NGS ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Microbiology 2019Quote: ... and peroxidase-labelled anti-rabbit EnVision™ secondary antibody (Dako). Following secondary antibody binding ...
-
bioRxiv - Biochemistry 2022Quote: ... HRP-conjugated anti-rabbit and anti-mouse antibody (DAKO-Agilent, Basel ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Swine Anti-Rabbit Ig/HRP (1:5,000, #P0217, Dako) as secondary antibody ...
-
bioRxiv - Immunology 2021Quote: ... or monoclonal rabbit anti-glucagon (dilution 1:100, A0565, Dako) for 1h ...
-
bioRxiv - Physiology 2019Quote: ... Secondary antibody (horseradish peroxidase coupled rabbit anti-rat IgG, Dako) was diluted 1:2500 in 1% blocking solution and incubated for 1 h at room temperature ...
-
bioRxiv - Physiology 2019Quote: ... Secondary antibody (horseradish peroxidase coupled swine anti-rabbit IgG, Dako) was diluted 1:5000 in blocking solution and incubated for 1 h at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-human tau was from Dako (1:8000, A0024). Other tau antibodies ...
-
bioRxiv - Immunology 2019Quote: ... Non-immunized rabbit serum (X0903; Agilent, Santa Clara, CA, USA) was used as the negative control for the polyclonal antibodies and irrelevant epitope monoclonal IgG1 ...
-
bioRxiv - Genetics 2019Quote: ... They were incubated overnight with anti-GFAP rabbit antibody (Dako) diluted at 1:500 in PBS ...
-
bioRxiv - Immunology 2019Quote: ... biotinylated rabbit anti-mouse IgG ([Code E0464]; Dako, Glostrup, Denmark) was added ...
-
bioRxiv - Microbiology 2021Quote: ... followed by incubation on rabbit anti mouse antibody (Z0259, DAKO) for 20 minutes and washed with PBS + 0.02M glycine ...
-
bioRxiv - Neuroscience 2021Quote: ... polyclonal rabbit anti-GFAP (1:1000; Cat. # Z0334, Dako, Agilent), polyclonal rabbit anti-IBA1 (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... polyclonal rabbit anti-GFAP (1:1000; Cat. # Z0334, Dako, Agilent), polyclonal rabbit anti-IBA1 (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit-anti-GFAP 1:1000 (Agilent Cat# N1506, RRID: AB_10013482), Chicken-anti-MAP2 1:1000 (Abcam Cat# ab75713 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-GFAP (1:500, Agilent, Santa Clara, CA, #N1506). Secondary antibodies used were Alexa Fluor 647-goat anti-rabbit IgG (1:400 ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit or mouse IgG (X0936 and X0931 respectively, Dako, USA) was used in negative controls ...
-
bioRxiv - Biochemistry 2020Quote: ... HRP-conjugated secondary anti-rabbit and anti-mouse antibodies (DAKO) were used at 1:1000 and 1:5000 respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-glial fibrillary acidic protein (GFAP, 1:1,000, DAKO), mouse anti-4A4 (1:2,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... and a goat anti-rabbit antibody (Dako, E0432, 1:500). Chromogenic detection was performed with the Bond Intense R Detection System (Leica ...
-
bioRxiv - Cell Biology 2021Quote: ... a rabbit polyclonal antibody (diluted 1:500; Z0458; DAKO, Denmark), a mouse monoclonal antibody (diluted 1:500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and subsequently with horseradish peroxidase conjugated anti rabbit antibody (Dako). They were then stained with 3,3’ diaminobenzidine (DAB ...
-
bioRxiv - Physiology 2022Quote: ... and polyclonal goat anti-rabbit immunoglobulin/HRP (1:1000, DAKO Agilent Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... Glial Fibrillary Acidic Protein (GFAP, rabbit, 1:300, Dako, Z0334); Ionized calcium-binding adapter molecule 1 (Iba1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HRP-labeled anti-rabbit secondary antibody (Dako EnVision, K4003, RTU) was applied for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... secondary anti-rabbit polymer (Cat. #K4003, Dako Agilent Pathology Solutions). All slides were exposed to brown chromogenic substrate DAB (Cat ...
-
bioRxiv - Microbiology 2020Quote: ... secondary anti-rabbit polymer (Cat. #K4003, Dako Agilent Pathology Solutions). All slides were exposed to brown chromogenic substrate DAB (Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... polyclonal rabbit: anti-GFAP (1:1000, Dako Cytomation, Glostrup, Denmark), anti-Cre (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... AS were labelled with rabbit α-GFAP antibody (Dako, Z0334), while microglial cells were stained with goat α-Iba1 antibody (Novus ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... in combination with goat-anti-rabbit-HRP (DAKO 1:10000) and goat-anti-mouse-HRP (DAKO ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse-HRP (1.3 μg/ml, rabbit polyclonal, Dako, P0260) and anti-goat-HRP (0.13 μg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were co-incubated with polyclonal rabbit anti-GFAP (Dako) for astrocytes ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-goat immunoglobulins/HRP (Agilent, cat. P0449, 1:10,000).
-
bioRxiv - Cancer Biology 2019Quote: ... Detection was achieved using the Envision rabbit detection system (Dako) with diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit glial fibrillary acidic protein GFAP (DAKO, ZO334, 1:1000), chicken GFP (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... Polyclonal Rabbit Anti-GFAP was obtained from Dako (Glostrup, Denmark).
-
bioRxiv - Immunology 2019Quote: ... a drop of Dako Envision+ HRP Anti-Rabbit Polymer (Agilent) was added to slides for one hour ...