Labshake search
Citations for Agilent :
1 - 50 of 1833 citations for Inactive Serine Protease 35 PRSS35 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: SopB and the inactive version were cloned into pESC-LEU (Agilent Technologies) for galactose inducible expression.
-
bioRxiv - Molecular Biology 2022Quote: ... Generation of the kinase inactive variants was achieved using QuikChange PCR (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibody was applied for 35 mins and secondary antibody (Rabbit Envision K4003, Agilent) for 30 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... The catalytically inactive Pep4 mutant was generated by using a modified version of the QuikChange protocol (Agilent). The construct VGc448 was used as template and the single primer 5’AAAACTTCAAGGTTATTTTGAAGACTGGATCCTCAAACCTTTGGGTTCCAAG was used to introduce the point mutation D109K and a diagnostic restriction site ...
-
bioRxiv - Genetics 2019Quote: ... The catalytically inactive point mutation C265S43 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to create T7-DNMT3B2 catalytic dead (CD) ...
-
bioRxiv - Biochemistry 2023Quote: The inactive mutant of LytMcat (LytMcat_H291A) was generated using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and the mutation was verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... The catalytically inactive ATGL(S47A) mutant was was made by site directed mutagenesis using the QuickChange II kit (Stratagene). PLIN2-GFP was a generous gift from Carole Sztalryd (University of Maryland) ...
-
bioRxiv - Neuroscience 2024Quote: ... The Lgmn mutation leading to an inactive LGMN C191A variant40,68 was introduced by site-directed mutagenesis using the QuickChange Site-Directed Mutagenesis Kit (# 200519, Agilent Technologies) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... The enzymatically-inactive pCAGGS-TMPRSS2(S441A)FLAG mutant cDNA was generated using QuickChange Site-Directed Mutagenesis Kit per manufacturer instructions (Agilent Technologies). Transient transfections of HEK-293T cells were performed using PolyFect transfection reagent per manufacturer instructions (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... HA-USP29 siRNA-resistant and the catalytically inactive USP29C294S were generated using the QuikChange® II XL Site-Directed Mutagenesis Kit (Stratagene) and the oligos reported in Table 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... and a serine at position 61 was replaced by a cysteine using the Quikchange kit (Agilent). GST-PHPLCδ1 was expressed in E ...
-
bioRxiv - Plant Biology 2020Quote: ... Different point mutations of cysteines to serines in GRXS17 were generated using QuikChange II Directed Mutagenesis Kit (Agilent) using primers detailed in Supplemental Table 2 ...
-
bioRxiv - Genetics 2019Quote: ... Serine-to-alanine mutation was generated using QuikChange II XL Site-directed Mutagenesis Kit (Agilent Technologies, CA, USA 200522) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... we substituted in the VH domain the serine at position 120 to an unpaired cysteine (14.4.4 scFV) via site directed mutagenesis (QuikChange II, Agilent technologies). In addition ...
-
bioRxiv - Cell Biology 2024Quote: ... The cysteine codons 233 and 235 of NBR9 were mutagenized to serine codons by QuikChange mutagenesis (Agilent, Waldbronn, Germany) to give plasmid pRK1891.
-
bioRxiv - Cancer Biology 2024Quote: ... The CDKN1B Serine 10 to alanine mutant reporter was cloned using the Quikchange II site-directed mutagenesis kit (Agilent).
-
bioRxiv - Molecular Biology 2020Quote: ... 35 was generated using site-directed mutagenesis (Agilent) of the MycTRF1.WT plasmid using the sense oligonucleotide 5’-CGGGGCTGTGCGGCTGCTAGGGATGCCGACCCT– 3’ and the antisense oligonucleotide 5’– AGGGTCGGCATCCCTAGCAGCCGCACAGCCCCG –3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pCS2HA-HA-LIX1 plasmid was used as template to generate the LIX1 variants in which cysteine 83 and 84 were substituted by serine residues with the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s protocol and the primers listed in supplemental Table S1.
-
bioRxiv - Biochemistry 2019Quote: ... vector encoding the pG gene as reported previously26 was site-specifically mutated by the insertion of an N-terminal serine using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), according to the manufacturer’s instructions using following forward and reverse primers (ser codon underlined) ...
-
bioRxiv - Molecular Biology 2022Quote: ... AAV-LK03insT and AAV-AM were created by inserting a Threonine or Glycine respectively immediately downstream of the Serine at position 264 of the AAV-LK03 capsid using the QuikChange in vitro mutagenesis kit (Agilent).
-
bioRxiv - Microbiology 2020Quote: ... a non-conserved cysteine (C232) was mutated to a serine with the aid of the QuickChange Lightning Site Directed Mutagenesis kit (Agilent technologies) and confirmed with DNA sequencing (ACGT DNA Technologies Corporation) ...
-
bioRxiv - Biophysics 2020Quote: ... The VDAC1 mutations at serine 215 to glutamate (S215E) was generated by PCR with QuikChange site-directed mutagenesis kit (Agilent Technology) using pET-VDAC1 as cDNA templates and the following primers ...
-
bioRxiv - Plant Biology 2020Quote: ... The separation was performed on a 35% phenyl siloxane column (30.0 m × 250 µm, 0.25 µm nominal) (Agilent HP-35, Part Number 19091G-133) as previously described ...
-
bioRxiv - Biochemistry 2023Quote: Samples were analyzed using a DB-35 column (Agilent Technologies). Information regarding additional technical specifications is available elsewhere [41,42].
-
bioRxiv - Plant Biology 2020Quote: ... the HY5 36th Serine (AGC) was changed into Alanine (GCC) and Aspartic Acid (GAC) respectively using Quickchange II site-directed mutagenesis kit (Agilent, Catalog #200523) and cloned into pB7FWG vectors ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by site-directed mutagenesis at Cys322 site to Serine using QuikChange Site-directed mutagenesis kit (Agilent, Santa Clara, CA; Fig. 1). 4RCF construct (four microtubule-binding repeats and cysteine-free construct containing C291S and C322S mutations ...
-
bioRxiv - Molecular Biology 2023Quote: ... two successive rounds of cysteine to serine mutagenesis were performed using the QuikChange Lightning Multi Site-directed Mutagenesis kit (Agilent Technologies #210513/#210515) according to manufacturer’s instructions at 1/4th scale.
-
bioRxiv - Plant Biology 2022Quote: ... DB-35 MS column (Agilent; 30 m × 250 μm × 0.25 μm film) was used for gas chromatography ...
-
bioRxiv - Molecular Biology 2024Quote: ... and heated for 3 minutes (35°-80°C) in a PCR machine (Agilent SureCycler 8800). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... Before sorting islet cells were filtered through a 35 µm filter and sorted using MoFlo Cytometer (Dako), where cells were gated according to forward scatter and then sorted based on endogenous fluorescence (Smelt et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... using the qualitative DNA Kit dsDNA Reagent 35-5000bp (Cat No. DNF-915, Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Plant Biology 2022Quote: ... Helium was used as carrier gas at a constant flow rate of 2 ml s-1 and GC was performed on a 30 m DB-35 column (capillary column, 30 m length, 0.32 mm inner diameter, 0.25 μm film thickness, PN: G42, Agilent). The injection temperature was 230 °C and the transfer line and ion source were set to 250 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... Helium was used as carrier gas at a constant flow rate of 2 ml s-1 and GC was performed on a 30 m DB-35 column (capillary column, 30 m length, 0.32 mm inner diameter, 0.25 μm film thickness, PN: G42, Agilent). The injection temperature was 230°C and the transfer line and ion source were set to 250°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The peptide separation was performed on a C18 reverse phase column (Agilent, Poroshell 120, 0.3×35 mm, 2.7 μL) with a linear gradient of 8-48% B over 30 min (A ...
-
bioRxiv - Biochemistry 2019Quote: Cells were plated at 35 000 cells per well in a 96-well XF cell culture microplate (Seahorse Bioscience). Cells were equilibrated for 1 h at 37 °C in bicarbonate-free IMDM media (pH 7.3 ...
-
bioRxiv - Microbiology 2024Quote: ... and then eluted on a reversed-phase analytical column (ZORBAX 300SB-C18, 0.5 x 35 mm, 3.5 µm, 300Å, Agilent Technologies). There LC separation proceeded at 25 µl/min flow rate through an 8 min gradient of 8– 30% solvent B ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Images were performed using a 35 mm Litzcage coil (Doty Scientific, Inc) on a 7T horizontal magnet (Agilent ASR 310) and (Bruker Biospin ...
-
bioRxiv - Biochemistry 2024Quote: ... The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise) by performing 35 consecutive readings per measurement in 4,000-650 cm-1 range using MicroLab PC software (Agilent Technologies) and further processed with Spectragryph (F ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the binding of small fragments (35-2000 bp) using a 2100 Bioanalyzer with an Agilent high-sensitivity DNA chip (Agilent Technologies).
-
bioRxiv - Plant Biology 2020Quote: ... The point mutation was introduced in the binary construct 35S-GFP-TOC159GM by using a site-directed mutagenesis kit (Agilent-QuikChangeII) with the primers TOC159S3F and TOC159S3R ...
-
bioRxiv - Microbiology 2019Quote: ... pBT270 was created by introducing the constitutive A1/04/03 promoter (35) and removing the trc promoter from pBT223 using the QuikChange Lightning Kit (Agilent Technologies) and the oligonucleotides OBT314 and OBT315 ...
-
bioRxiv - Plant Biology 2024Quote: ... We used a Zorbax SB-C18 5 μm 4.6 x 250 mm column at 35°C on a 1260 Infinity HPLC instrument with a fluorescence detector (Agilent Technologies, Santa Clara CA) using an excitation wavelength of 340 nm and emission wavelength of 510 nm ...
-
bioRxiv - Pathology 2020Quote: ... Antibodies were diluted in antibody diluent (Dako). Immunostained samples were analyzed with a fluorescence microscope (Olympus DP72) ...
-
bioRxiv - Cell Biology 2023Quote: ... primary antibodies prepared in antibody diluent (Agilent) were added for 8 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Pathology 2021Quote: ... 4μL of completed PCR products were analyzed using a Fragment Analyzer 5200 fitted with 33 or 55cm electrophoresis capillaries loaded with matrix capable of resolving dsDNA between 35 and 1500bp (Advanced Analytics, Agilent, Santa Clara, CA, USA). Capillary absorbance traces were analyzed and converted into pseudo-gel images using PROSize 3.0 software (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809; Agilent Technologies). Images were captured by confocal microscopy (Leica DMi8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and applied for 45 minutes at room temp ...