Labshake search
Citations for Agilent :
251 - 300 of 965 citations for IL 3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Immunology 2024Quote: ... The insertion of DNA encoding His-tag was performed using appropriate primers (Table 1) and a PfuUltra high-fidelity DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) PCR reaction.
-
bioRxiv - Cancer Biology 2021Quote: ... immunohistochemical staining was done with an antibody against human Ki67 (M7240, DAKO). 10 μm-thick tumor cryosections were fixed with a 4% PFA solution ...
-
bioRxiv - Genomics 2020Quote: ... pre-capture PCR and SureSelectXT Human All Exon V5+UTR baits (Agilent). Post-capture fragments were amplified by PCR ...
-
bioRxiv - Genomics 2020Quote: ... Lysates and positive controls (Human Universal Reference RNA - uhrRNA (Agilent Cat# 740000), and Human Brain Total RNA brRNA (ThermoFisher AM7962)) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human KIF4A was amplified using Pfu hot start turbo polymerase (Agilent Technologies). Mammalian expression constructs were made in pcDNA5/FRT/TO (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... The antibodies used were the polyclonal rabbit anti-human β2M antibody (Dako) (used at 1/1000) ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies used in IHC assays include: mouse-anti-human CD3 (Dako, F7.2.38), rabbit-anti-human Granzyme B (eBiosciences ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... Hybridization to SurePrint G3 Human Gene Expression 8×60K Microarrays (Agilent Technologies) was performed with the Gene Expression Hybridization Kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... Akata cells were treated with polyclonal rabbit anti-human IgG (Agilent, A0423) at 7.5 μg/mL for 8 or 24 h ...
-
bioRxiv - Genetics 2021Quote: ... we used the i) Agilent SureSelectXT Human All Exon V6 (Agilent Technologies), ii ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections were incubated with rabbit anti-human PGP 9.5 (DAKO 1:100) overnight at 4°C.
-
bioRxiv - Cancer Biology 2022Quote: The human CDK1 S39A mutation was introduced using Quickchange (Agilent, cat #600670) using specific primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The exons were captured using SureSelect XT2 Human All Exon V6 (Agilent), and sequenced by paired-end 75 bp sequencing on HiSeq4000 (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... GFAP was detected with polyclonal rabbit-anti human GFAP (1:500, Agilent) and donkey anti-rabbit IgG AF55 detection (1:500 ...
-
bioRxiv - Immunology 2019Quote: ... Sections were incubated with mouse anti-human CD68 (#M0814, Clone KP1, Dako) antibody (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-human PECAM-1 (CD31) (M0823, Agilent Dako, Santa Clara, CA), GAPDH mouse anti-human (10R-G109b ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-human PECAM-1 (CD31) (M0823, Agilent Dako, Santa Clara, CA), GAPDH mouse anti-human (10R-G109b ...
-
bioRxiv - Immunology 2020Quote: ... or rabbit anti-human IgA/HRP (Dako: cat. P0216, 1:5’000 dilution). Assays were developed by addition of 3,3’,5,5’-Tetramethylbenzidine (TMB ...
-
bioRxiv - Microbiology 2020Quote: ... Bound antibodies were detected using HRP-labelled rabbit anti–human IgG (Dako) or anti-hamster IgG and TMB (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: Immunohistochemistry on human (antigen retrieval by Target Retrieval Solution pH6.0 (DAKO #S1699)) and mouse fetal tissue was performed using Autostainer (Dako ...
-
bioRxiv - Genomics 2021Quote: ... MAQCA is the Quantitative PCR Human Reference Total RNA (#750500, Agilent technologies), extracted from cell lines representing different human tissues ...
-
bioRxiv - Immunology 2020Quote: ... Monoclonal mouse IgG1 anti-human CD32 (clone KB61) was purchased from Dako, Santa Clara ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The NCBI BioProject database accession number is PRJNA600674 ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The Gene Expression Omnibus accession number is PRJNA600674 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human ARRB2 cDNA was cloned into pCMV-3Tag-8 (Agilent Technologies). The plasmid contains three copies of a FLAG epitope tag fused in-frame to the 3’ end of the ARRB2 cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Whole-exome sequencing was performed using SureSelect Human All Exon V7 (Agilent) according to manufacturer’s protocol and sequenced on an Illumina NextSeq 500 (paired-end 150 bp reads) ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated with primary antibodies against human CD31 (1:50, JC70A, Dako), PDGFRβ (1:100 ...
-
bioRxiv - Genetics 2023Quote: ... Microdeletions were identified by array-CGH (Human Sureprint 2×105K, Agilent technologies) and confirmed with semiquantitative PCR ...
-
bioRxiv - Physiology 2024Quote: ... Hybridization to SurePrint G3 Human Gene Expression 8×60K Microarrays (Agilent Technologies) was performed with the Gene Expression Hybridization Kit (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary antibody was mouse anti-human Aβ (Dako #M0872; 1:400) and the secondary antibody was Vectastain ABC kit anti-mouse secondary antibody (Vector Laboratories #PK-4002 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then immunostained using an anti-human Ki-67 (Dako # M724001) antibody and nuclear DNA was stained using 4,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to a nitrocellulose membrane before probing using a primary anti IL-36γ antibody (Biotechne (R&D) UK) overnight at 4°C and a secondary goat antibody (Dako) for 1 hour at room temperature to visualise any protein cleavage.
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: 10 ul of RNA combined with 25 ng Human Universal Reference RNA (Agilent) was purified by PureBeads (Roche Sequencing) ...
-
bioRxiv - Genomics 2020Quote: ... Slides were additionally co-stained with rabbit anti-human vWF polyclonal antibody (Dako) at a dilution of 1:100 overnight at 4°C followed by donkey Alexa488-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD68 (Dako, clone PG-M1, 1:750, pH 6 retrieval), mouse anti-human CD20 (Dako ...