Labshake search
Citations for Agilent :
151 - 200 of 980 citations for IL 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The pET-30a-PHB1 vector encoding His-tagged mouse PHB1 was transformed into Escherichia coli strain BL21 Star (DE3; Stratagene). The resulting N-terminal His-tagged recombinant PHB1 was purified using Ni-Sepharose 6 Fast Flow (GE Healthcare) ...
-
bioRxiv - Genomics 2023Quote: ... 500-1000ng of Hi-C library were captured using the SureSelectXT Target Enrichment System for the Illumina Platform (Agilent Technologies) as instructed by the manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Genomics 2019Quote: Same amounts of early and late-labeled DNA were loaded on mouse or human DNA microarrays (SurePrint G3 Human CGH arrays, Agilent Technologies, G4449A). Hybridization was performed as previously described (Hadjadj et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Same amounts of early and late-labeled DNA were loaded on human DNA microarrays (SurePrint G3 Human CGH arrays, Agilent Technologies, G4449A). Hybridization was performed as previously described (39) ...
-
bioRxiv - Biochemistry 2023Quote: ... Same amounts of early and late-labelled DNA were loaded on human DNA microarrays (SurePrint G3 Human CGH arrays, Agilent Technologies, G4449A). Hybridization was performed at 65°C as previously described43 ...
-
bioRxiv - Cell Biology 2020Quote: ... For the anti-human Fibronectin immunostaining (Dako, 1:1000) a single immunostaining was performed with a goat anti-rabbit secondary antibody and Alexa-568 phalloidin ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-human Chorionic Gonadotropin (hCG, A0231, Dako, 1:300), anti-ENDOU (HAP067448 ...
-
bioRxiv - Genetics 2019Quote: ... using the Cy3-labeled Universal Human Reference cRNA (Agilent). Genes that showed significant change of expression (normalized to DMSO control-treated samples ...
-
bioRxiv - Immunology 2019Quote: ... and rabbit anti-human myeloperoxidase (A039829-2, Dako, USA) at 1:300 ...
-
bioRxiv - Developmental Biology 2019Quote: ... or mouse anti-human CD31 (Dako, M0823, 1:50) overnight at 4°C and then goat anti-mouse Alexa488 (ThermoFisher Scientific ...
-
Targeting MOG to skin macrophages prevents EAE in macaques through TGFβ-induced peripheral tolerancebioRxiv - Immunology 2019Quote: ... and with rabbit anti-human IgM (1:250, Dako). Incubation with primary antibodies was followed by a biotinylated goat-anti-rabbit antibody for 30 min followed by the avidin–biotin–peroxidase complex (Vectastain Elite ABC Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... A Universal Human Reference (UHR) (Chem-Agilent, Catalog #740000) was sequenced with each batch of samples to allow for assessment and removal of technical artifacts (due to ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA samples were performed to Microarray analysis by Agilent SurePrint G3 human gene expression Microarray 8X60K (Agilent Technologies). After hybridization ...
-
bioRxiv - Genomics 2022Quote: Universal Human Reference RNA (UHRR) was purchased from Agilent (product name ...
-
bioRxiv - Genetics 2022Quote: Preparation of the universal human reference RNA (Agilent, 74000) was done according to the manufacturer’s manual ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... A monoclonal mouse anti-human αSMA antibody (Dako, Denmark) was incubated for 2 hours at room temperature after antigen retrieval ...
-
bioRxiv - Cancer Biology 2020Quote: ... Library preparation (Agilent SureSelect Human All Exon V6 kit) and high throughout sequencing (Illumina NovaSeq 6000 ...
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Cell Biology 2021Quote: ... and IgA (rabbit anti-human, Dako, A0262, 1:75). For amplified targets the appropriate HRP-conjugated secondary was then incubated at 1:250 in PBS for 45 minutes-1hr followed by TSA fluorophore treatment (Akoya) ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-human Chorionic Gonadotropin (CBG, A0231, Dako, 1:1000), anti-ENDOU (HAP067448 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tumor sections were stained for human Ki67 (Dako, #M7240) using the Target Retrieval Solution pH 9.0 (Dako ...
-
bioRxiv - Microbiology 2022Quote: ... Sections were stained with mouse anti human CMV (Dako, Agilent technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal CD31 anti-human clone JC70A (M0823, Agilent Dako ...
-
bioRxiv - Neuroscience 2022Quote: ... wild type human TTC3 in pCMV-Tag2 vector (Stratagene), mouse AUTS2-myc-DDK in pCMV6 (OriGene ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse monoclonal anti-human CD31 (Agilent, clone DAKO JC70A), mouse monoclonal anti-HLA class II-DR/DP/DQ (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse monoclonal anti-human CD31 (Agilent, clone DAKO JC70A), mouse monoclonal anti-HLA class II-DR/DP/DQ (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... and immunolabelled for human CD31 (Dako, JC70A, 1:50), VE-Cadherin (1:100 ...
-
bioRxiv - Immunology 2023Quote: ... human albumin (diluted 1:1000; Dako, Carpinteria, CA, USA), complement C3 (diluted 1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... HindIII-based Hi-C libraries from our previous study (Wutz et al., 2017) were captured using SureSelect target enrichment system (Agilent Technologies) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the eight genes flanked with the same promoters and terminators were cloned into the 2μ-based high-copy plasmids pESC-URA-USER and pESC-HIS (#217451, Agilent Technologies), resulting in pESC-URA-USER harboring CYP79A2 ...
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each Hi-C library (750 ng) was hybridized and captured individually using the SureSelectXT Target Enrichment System reagents and protocol (Agilent Technologies). After library enrichment ...
-
bioRxiv - Evolutionary Biology 2021Quote: Evolved viral genomes of the passage 12 from each lineage and genotype were amplified by high-fidelity RT-PCR using the AccuScript Hi-Fi (Agilent Technologies) reverse transcriptase and Phusion DNA polymerase (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptides were subjected to C18 desalting using an Agilent 1260 Infinity LC system equipped with an MRP-C18 Hi-recovery column (Agilent, USA) before SpeedVac drying.
-
bioRxiv - Microbiology 2022Quote: ... and analysed by HPLC Shimadzu, Prominence-I (Milton Keynes, UK) with an ion exchange column Hi PlexH (300 × 7.7 mm) (Agilent, Cheadle, UK) and 0.6 mL min-1 flow rate at 55 ºC (oven temperature ...
-
bioRxiv - Genomics 2023Quote: The fragment size distribution and concentration of the final PacBio and Dovetail Hi-C libraries were assessed using the TapeStation (Agilent Technologies) and the Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid construct (pRK172-human-lil-synuclein) encoding WT-human-α-synuclein was expressed in BL21-CodonPlus (DE3-RIL) cells (Agilent, Cat# 230245-41). Protein expression was induced with 0.1 mM IPTG at cell density OD (600 nm ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...