Labshake search
Citations for Agilent :
101 - 150 of 911 citations for IL 3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... A Universal Human Reference (UHR) (Chem-Agilent, Catalog #740000) was sequenced with each batch of samples to allow for assessment and removal of technical artifacts (due to ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA samples were performed to Microarray analysis by Agilent SurePrint G3 human gene expression Microarray 8X60K (Agilent Technologies). After hybridization ...
-
bioRxiv - Genomics 2022Quote: Universal Human Reference RNA (UHRR) was purchased from Agilent (product name ...
-
bioRxiv - Genetics 2022Quote: Preparation of the universal human reference RNA (Agilent, 74000) was done according to the manufacturer’s manual ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... A monoclonal mouse anti-human αSMA antibody (Dako, Denmark) was incubated for 2 hours at room temperature after antigen retrieval ...
-
bioRxiv - Cancer Biology 2020Quote: ... Library preparation (Agilent SureSelect Human All Exon V6 kit) and high throughout sequencing (Illumina NovaSeq 6000 ...
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Cell Biology 2021Quote: ... and IgA (rabbit anti-human, Dako, A0262, 1:75). For amplified targets the appropriate HRP-conjugated secondary was then incubated at 1:250 in PBS for 45 minutes-1hr followed by TSA fluorophore treatment (Akoya) ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-human Chorionic Gonadotropin (CBG, A0231, Dako, 1:1000), anti-ENDOU (HAP067448 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tumor sections were stained for human Ki67 (Dako, #M7240) using the Target Retrieval Solution pH 9.0 (Dako ...
-
bioRxiv - Microbiology 2022Quote: ... Sections were stained with mouse anti human CMV (Dako, Agilent technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal CD31 anti-human clone JC70A (M0823, Agilent Dako ...
-
bioRxiv - Neuroscience 2022Quote: ... wild type human TTC3 in pCMV-Tag2 vector (Stratagene), mouse AUTS2-myc-DDK in pCMV6 (OriGene ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse monoclonal anti-human CD31 (Agilent, clone DAKO JC70A), mouse monoclonal anti-HLA class II-DR/DP/DQ (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse monoclonal anti-human CD31 (Agilent, clone DAKO JC70A), mouse monoclonal anti-HLA class II-DR/DP/DQ (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... and immunolabelled for human CD31 (Dako, JC70A, 1:50), VE-Cadherin (1:100 ...
-
bioRxiv - Immunology 2023Quote: ... human albumin (diluted 1:1000; Dako, Carpinteria, CA, USA), complement C3 (diluted 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid construct (pRK172-human-lil-synuclein) encoding WT-human-α-synuclein was expressed in BL21-CodonPlus (DE3-RIL) cells (Agilent, Cat# 230245-41). Protein expression was induced with 0.1 mM IPTG at cell density OD (600 nm ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-human tau was from Dako (1:8000, A0024). Other tau antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Immunohistochemistry (IHC) for human CD45 antibodies (IR75161-2, Agilent Technologies) was performed on FFPE blocks of engrafted tumors to identify cases of lymphomagenesis ...
-
bioRxiv - Immunology 2022Quote: ... the plates were incubated with either anti-human-HRP (Dako), anti-rat-HRP (Invitrogen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... (30) using the SureSelectXT Human All Exon 50 Mb (Agilent) bait set ...
-
bioRxiv - Cancer Biology 2020Quote: ... monoclonal mouse anti-human alpha smooth muscle actin (M0851, Dako), monoclonal mouse anti-human CD68 (M0814 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 1:400 diluted Rabbit anti-human calcitonin (Dako, Denmark) at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Samples were analyzed against the Stratagene Universal Human Reference (Agilent). Raw fluorescence intensities were quantified and normalized (Lowess normalization ...
-
bioRxiv - Cell Biology 2021Quote: ... IgA heavy chain (rabbit anti-human, Dako, A0262 1:1000) and secretory component/pIgR (goat anti-human ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-SMA (1:67, human, Dako, M0851, Santa Clara, CA) with secondary donkey anti-mouse Cy3 (1:200 ...
-
bioRxiv - Immunology 2020Quote: ... 0.006 g/L polyclonal rabbit anti-human CD3 antibody (Dako A0452 ...
-
bioRxiv - Cancer Biology 2020Quote: ... whole Human Genome 44 K arrays (Agilent Technologies, product G4112A) were used for stroma and epithelial expression profiles ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal CD31 anti-human clone JC70A (M0823, Agilent Dako, Santa Clara ...
-
bioRxiv - Genetics 2022Quote: ... including A sample (Universal Human Reference RNA, Agilent Technologies, Inc.) and B sample (Human Brain Reference RNA ...
-
bioRxiv - Immunology 2023Quote: ... stimulation with rabbit anti-human IgE (Dako, Carpinteria, CA, USA) and fMLP (N-Formylmethionine-leucyl-phenylalanine ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-human CD68 (Dako #M0814, 1:400 dilution), following by the secondary antibody incubation and chromogenic detection with DISCOVERY Purple and Yellow kits (Ventana-Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Agilent SureSelect Human All Exon v6 kit (Agilent Technologies) was used for whole exome sequencing ...
-
bioRxiv - Genetics 2024Quote: ... The exomes of the subjects were captured by Agilent SureSelect Human All Exon V6 Enrichment kits (Agilent, CA, USA) and then sequenced on a HiSeq X-TEN system (Illumina ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...