Labshake search
Citations for Agilent :
351 - 400 of 572 citations for IL 10 Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... N≥50 worms (10 worms/ well) were transferred to the Seahorse XF96 Cell Culture Microplate (Agilent Technologies, 101085-004) in a total volume of 180 uL ...
-
bioRxiv - Neuroscience 2019Quote: Fractions were reconstituted in 10% FA and analyzed in two technical replicates with a UHPLC 1290 system (Agilent technologies) coupled to an Orbitrap Q Exactive X mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2019Quote: ... From each sample 10 µl was injected onto a SEC-3 HPLC column (300 Å pore size; Agilent Technologies) equilibrated with HKMC at a flow rate of 0.3 ml/min ...
-
bioRxiv - Genetics 2020Quote: ... We determined efficiency of each reaction using the equation Efficiency = −1+10(−1/slope of standard curve) (Agilent Genomics). We additionally calculated ratios of transcript abundance to determine expression levels of one gene relative to another gene and to account for any differences in underlying mRNA levels among individuals ...
-
bioRxiv - Biochemistry 2021Quote: A serum volume of 10 µL was diluted ten times with load/wash buffer solution (Agilent Cat.#: 5185-5987). Each sample was filtered through a 0.22-μm spin filter (Agilent Cat.# ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8–10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Immunology 2022Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Microbiology 2022Quote: ... We then amplified 3 µL of cDNA (10 ng/µL) in Power SYBR (Thermo) with 1.6 µM primers using the AriaMx real-time PCR system (Agilent) in a volume of 12 µL ...
-
bioRxiv - Microbiology 2022Quote: ... contained a fused-silica fibre of 80μm x 10 mm coated with a layer of divinylbenzene–carboxen–polydimethylsiloxane (DVB/CWR/PDMS) (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the assay medium was prepared by supplementing Seahorse XF Base medium (pH 7.4) with a specific combination of 10 mM glucose (100X stock, Agilent), 1 mM pyruvate (100X stock ...
-
bioRxiv - Cancer Biology 2023Quote: ... intact poly(A) RNA was purified from 100-500 ng of RNA (RIN 8-10, Agilent Technologies 2200 TapeStation) with oligo(dT ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions contained 10 µL of 2× Brilliant III Ultra-Fast SYBR green QPCR master mix (catalog no. 600882; Agilent), 2 µL each of 2 µM PCR primers (see Table S1 for used primers) ...
-
bioRxiv - Cancer Biology 2022Quote: PBMs were performed on universal ‘all 10-mer’ arrays in 8 x 60K format (GSE AMADID # 030236, Agilent Technologies) essentially as described previously (Berger and Bulyk 2009 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The protein (10 μL) was loaded by an LC system (Agilent 1290 Infinity II, Agilent Technologies, Santa Clara, CA) on a HPLC column (PLRP-S 1000 Å ...
-
bioRxiv - Physiology 2023Quote: ... Secreted protein in cell culture media was enriched using StrataClean Resin (Agilent, 10 µl per 5 ml of media) as previously described11,24.
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent] ...
-
bioRxiv - Immunology 2023Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8-10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: The fatty acid profile and content in 10 mg of each fecal sample were determined by gas chromatography (Agilent Technologies 6890 N Series Gas Chromatograph ...
-
bioRxiv - Cell Biology 2024Quote: ... the buffer was exchanged into basic PBS (pH 8.0) with 0.1 % Tween-20 for a 2 h conjugation with 10 µM streptavidin (Prozyme, SA10) and 10 µM fluorescent dye (Lissamine Rhodamine B ethylenediamine ...
-
bioRxiv - Biochemistry 2024Quote: ... linear gradient from H2O/MeCN + 0.1 trifluoracetic acid from 10 to 90% over 60 min) on a 1260 Infinity II LC System (Agilent). Peaks were collected manually according to the peak height at 480 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... The CDKN1B Serine 10 to alanine mutant reporter was cloned using the Quikchange II site-directed mutagenesis kit (Agilent).
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... and 10 µl samples injected into an Agilent Technologies 6420 Triple Quad Liquid Chromatography-Tandem Mass Spectrometry instrument (Agilent, USA). A Zorbax Extend-C18 column 3.0×150mm (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were isolated from 10% non-denaturing gels by size selection and their quality and quantity measure by DNA high sensitivity chips (Agilent) with Bioanalyzer and Qubit.
-
bioRxiv - Molecular Biology 2021Quote: ... Forty reaction cycles of 10 s at 95 and 30 s at 58 °C were carried out on a Multiplex 3005 Plus (Stratagene/Agilent). The amplicon coordinates relative to the 47S rRNA initiation site (BK000964v3 ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were resuspended in 10% formic acid (FA)/5% DMSO and analyzed with an Agilent 1290 Infinity (Agilent Technologies, CA) LC ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was carried out in a 20 μl reaction volume containing 10 μl Brilliant III SYBR Green Master Mix (Agilent), 500 nM of primers ...
-
A DNA-based optical nanosensor for in vivo imaging of acetylcholine in the peripheral nervous systembioRxiv - Bioengineering 2020Quote: ... AChE and BTX were separated from other impurities by a size-exclusion column (Superdex 200 increase 10/300 GL column, GE Health) via HPLC (Infinity 1260, Agilent). The elution solution was 0.15 M phosphate buffer with NaCl concentration of 500 mM ...
-
A DNA-based optical nanosensor for in vivo imaging of acetylcholine in the peripheral nervous systembioRxiv - Bioengineering 2020Quote: ... Misfolded DNA scaffolds were removed by a size-exclusion column (Superdex 200 increase 10/300 GL column, GE Health) via HPLC (Infinity 1260, Agilent) using phosphate buffer (500 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative real-time PCR (qPCR) was assayed in 10 μl reactions with Brillant III Ultra Fast SYBR-Green Mix (Agilent) using a Stratagene MX3005p system ...
-
bioRxiv - Plant Biology 2020Quote: ... except approximately 10 seedlings were used per RNA sample and analysis was performed using an MXPro 3005 real time PCR system (Agilent) with 5x HOT FIREPol EvaGreen qPCR mastermix (Solis Biodyne) ...
-
bioRxiv - Microbiology 2021Quote: Qualitative and quantitative measurements of viral load were determined by quantitative RT-PCR,10 ul of RNA combined with 25 ng Human Universal Reference RNA (Agilent) was purified by PureBeads (Roche Sequencing) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed 3 times 10 min in Tris-Triton Solution and mounted on gelatin-coated slides using Fluorescence Mounting Medium (Dako). Z-stack images (4 optical sections ...
-
bioRxiv - Cell Biology 2021Quote: RNAi-resistant EGFP-ORP5A and EGFP-ORP5B were generated by introducing 4 silent point mutations in the region targeted by the 2 siRNA oligos (#10 and #11) by site-directed mutagenesis (Quickchange II-XL, Stratagene) and the following primers:
-
bioRxiv - Physiology 2021Quote: ... Samples were washed with PBS twice and were either blocked for 10 min at room temperature (Dako protein block #X0909), or with goat block (GB ...
-
bioRxiv - Physiology 2021Quote: ... Samples were washed with PBS twice and were either blocked for 10 min at room temperature (Dako protein block #X0909), or with goat block (GB ...
-
bioRxiv - Biochemistry 2020Quote: The supernatants of the quenched in vitro OMT reactions and fermentation samples were analyzed by reversed-phase HPLC (instrument: Agilent 1100; autosampler: HiP sampler G1367A, T=4°C, 10 μL injection; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μl Brilliant III Ultra-Fast SYBR® Green Low ROX qPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA) and 0.8 μl of each primer (10 μM) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% or 10% milk overnight followed by 1 hour incubation with the indicated primary antibodies followed by HRP conjugated secondary antibodies (Dako) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... wild-type and porthos KD cells were seeded at 10 × 105 cells per well in Seahorse XF96 polystyrene tissue culture plates (Agilent) and incubated in unbuffered Seahorse RPMI assay medium (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were incubated in 100 ng/mL DAPI for 10 minutes before mounting slides using the Fluorescent mounting medium (DAKO). Cells were visualized on Zeiss LSM780 confocal microscope using the ZEN software ...
-
bioRxiv - Biochemistry 2022Quote: ... was taken up in 20 mM ammonium formate (pH 10) and prefractionated first into 29 fractions on a 1200 Infinity HPLC (Agilent) using high-pH reversed-phase chromatography (running buffer A ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 μl was used for a 10 μl qPCR reaction with 5 μl THUNDERBIRD SYBR Green mix (Toyobo) on an Mx3000P qPCR System (Agilent) using the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... Converted libraries were enriched by 10 cycles of PCR with the following reaction composition: 1 μl Pfu TurboCx Hotstart DNA polymerase (Stratagene), 5 μl PfuTurbo Cx reaction buffer ...
-
bioRxiv - Neuroscience 2021Quote: Mouse brain cryosections for studying transmitophagy in vivo were blocked with 10% normal goat serum for 30 minutes at room temperature and incubated with an anti-GFAP primary antibody (Dako, Z033429-2 ...