Labshake search
Citations for Agilent :
201 - 250 of 1239 citations for IGFBP 7 Mouse HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-human IgG4 (Nordic clone N315, Nordic MUbio) and rabbit anti-mouse-AP (D0314, Dako) were used as secondary antibodies and conjugate respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody, E0413, Dako, 1:200). Histopathological studies of GBM xenograft mice were conducted by Division of Neuropathology ...
-
bioRxiv - Cancer Biology 2021Quote: ... or anti-mouse secondary antibody (DakoCytomation) and a commercially available tyramide-based avidin-biotin amplification system (Catalyzed Signal Amplification System ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-KI67(MIB1, DAKO, M7240), 1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-DESMIN (1:200; Dako), rat anti-F4/80 (1:200 ...
-
bioRxiv - Genomics 2020Quote: ... anti-KRT7 (mouse monoclonal, Dako, M7018), anti-CDH1 rabbit monoclonal (Cell Signaling ...
-
bioRxiv - Developmental Biology 2019Quote: ... or mouse (Dako, M7240, 1:50) anti-Ki67 monoclonal antibody ...
-
bioRxiv - Pathology 2019Quote: ... and mouse anti-human CD31 (DAKO) was applied overnight at 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Rabbit/Mouse (ENV, Dako, Glostrup, Denmark), the slides were further incubated for 30 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2019Quote: The Whole Mouse Genome Microarray (Agilent) contains 43,379 probes including 22,210 transcripts from 21,326 genes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse (goat, Dako, 1:2000), anti-rat (rabbit ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-Ki67 (Dako, 1:500), rabbit anti-GFAP (Dako ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-IgG-mouse-HRP (Dako, P0447) anti-IgG-Goat-HRP (Santa Cruz ...
-
bioRxiv - Molecular Biology 2020Quote: ... Secondary antibodies for mouse (Agilent, #P0260), rabbit (Agilent ...
-
bioRxiv - Immunology 2019Quote: ... Goat Anti-Mouse Immunoglobulin/HRP (Agilent) was used at a 1:1 dilution for 10 minutes and then washed with PBS-T ...
-
Hypusinated eIF5A is expressed in pancreas and spleen of individuals with type 1 and type 2 diabetesbioRxiv - Cell Biology 2019Quote: ... mouse anti-Pax5 (DAKO; 1:200), mouse anti-CD8 (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... and rabbit anti-mouse/HRP (DAKO)-conjugated secondary were incubated with the blots to detect GBA2 (rabbit polyclonal antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-synaptophysin (1:500, Dako), rabbit anti-PSD-95 (1:500 ...
-
bioRxiv - Physiology 2021Quote: ... monoclonal mouse anti-PCNA (Dako, #M0879) and polyclonal rabbit anti-ZO-1 (ZYMED 617300 ...
-
bioRxiv - Bioengineering 2020Quote: ... and CD31 (Dako, mouse, 1:200) diluted in the blocking buffer (3% BSA ...
-
bioRxiv - Immunology 2021Quote: ... or universal negative control mouse (Dako) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and mouse IgG2b isotype control (Dako) were used to evaluate non-specific binding ...
-
bioRxiv - Cancer Biology 2022Quote: ... Synaptophysin (DAK-SYNAP, Mouse monoclonal, Dako) at 1:200 ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD8 (C8/144B, Mouse monoclonal, Dako) at 1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD68 (PG-M1, Mouse monoclonal, Dako) at 1:100 ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-mouse antibody (Dako, P0260) in dilution buffer (final concentration 1.3 ng/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse α CD45 (1:50; DAKO), and rabbit α Iba-1 (1:800 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (GFAP anti-mouse Dako M0761 ...
-
bioRxiv - Immunology 2022Quote: ... and Mouse IgG1 Control (X0931, Dako) were diluted to same concentration as primary antibodies respectively as isotype controls ...
-
bioRxiv - Molecular Biology 2023Quote: ... or rabbit anti-mouse (Dako, PO260) secondary antibodies ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-mouse (Dako,catalog no. P0260), and anti-mouse (ZSGB-BIO ...
-
bioRxiv - Cancer Biology 2023Quote: ... goat anti-mouse IgG (Dako Agilent), and Peroxidase AffiniPure Donkey Anti-Human IgG (Jackson ImmunoResearch ...
-
bioRxiv - Pathology 2023Quote: ... Envision® + system (anti-mouse) (Dako, https://www.agilent.com/en/dako-products ...