Labshake search
Citations for Agilent :
101 - 150 of 7907 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... human stem cell-derived ECs were cultured in the xCELLigence RTCA SP (Agilent) device and treated with cARLA or control medium exactly as described above ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Cancer Biology 2024Quote: ... Drug was then washed out and 1x105 cells plated in 5 replicate wells for immediate analysis using the Mito Stress Test Kit (Agilent, 103015-100) according to the manufacturer’s instructions and using the following drug concentrations ...
-
bioRxiv - Molecular Biology 2019Quote: ... m6A-mut CIRBP reporter was generated by mutating the essential C in the m6A site synonymously to T using two rounds of site-directed mutagenesis with the QuikChange Lightning kit (Agilent).
-
bioRxiv - Genetics 2020Quote: ... The A>T variant was introduced to PIK3C2B-pNL construct by site-directed mutagenesis using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) to generate PIK3C2B-A>T-pNL construct ...
-
bioRxiv - Cancer Biology 2022Quote: 5 × 104 cells were plated on XF24 cell culture plate (Agilent, no. 100777-004) with DMEM supplemented with 1 % FBS ...
-
bioRxiv - Genomics 2023Quote: ... cell counts were measured using a Cytation 5 Cell Imaging Multimode Reader (Agilent BioTek).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were harvested from the T-75 flasks and seeded into a Seahorse 96-well XF Cell Culture microplate (Agilent Seahorse Bioscience, CA, USA) in 80 µL of the culture medium at a density of 20,000/well ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis of the human l/r-pyk gene was performed with a QuikChange kit (Stratagene). Proteins were expressed in the FF50 strain of Escherichia coli 8 that has both native E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-exome libraries were prepared using a SureSelectXT Human All Exon V5 kit (Agilent Technologies). The RNA seq library from tumor RNA was prepared using Illumina TruSeq Stranded mRNA Library Prep Kit as per the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: Libraries were generated using the Agilent SureSelect Human All Exon V6 kit (Agilent Technologies, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... genomic DNA libraries were prepared using the SureSelect Human All Exon V6 kit (Agilent Technologies). Exome libraries were subjected to next generation sequencing using DNBseq platform (MGI ...
-
bioRxiv - Genetics 2023Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent). Sequencing was done on a HiSeq4000 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... WES libraries were prepared using the SureSelect Human All Exon V8 Kit (Agilent; 5191-6873) and sequenced on either a NextSeq 2000 (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Immunology 2024Quote: T cell oxygen consumption rate (OCR) was measured using a Seahorse XFe96 Extracellular Flux Analyzed following established protocols (Agilent). Briefly ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Biophysics 2023Quote: ... or K280C (T) as well as the C242A mutation were introduced into the pETM30 vector using the QuikChange® mutagenesis kit (Stratagene) (17) ...
-
bioRxiv - Physiology 2023Quote: ... An antibody for von Willebrand factor was obtained from Dako (Glostrup, Denmark). Antibodies for rabbit IgG ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were imaged using the BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent Technologies) to collect baseline GFP intensity ...
-
bioRxiv - Cancer Biology 2022Quote: ... All sections were counterstained with nuclear DAPI (1:1000) and mounted with fluorescent mounting medium (Dako).
-
bioRxiv - Cancer Biology 2021Quote: ... libraries for whole-exome sequencing were prepared using the SureSelect Human All Exon V7 kit (Agilent) and the Illumina TruSeq Exome kit ...
-
bioRxiv - Cancer Biology 2021Quote: The sequencing libraries were prepared and captured using SureSelect Human All Exon V4 kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... whole-exome DNA was capture using the SureSelect Human All Exon Kit V5 or V6 (Agilent) and high-throughput sequencing was conducted using the Illumina X10 with a coverage more than 100 X ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using the Agilent SureSelect Human All Exon kit (Agilent Technologies, CA, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... 3×105 CD8+ T cells were plated onto poly-D-lysine coated wells and assayed in XF RPMI medium (Agilent) pH 7.4 supplemented with 10 mM glucose and 2 mM glutamine ...
-
bioRxiv - Immunology 2023Quote: ... using the Cytation 5 Cell Imaging Reader (Agilent BioTek, CA, USA). Lactate levels present in the samples were estimated from the standard curve.
-
bioRxiv - Bioengineering 2024Quote: ... Cell invasion depth was measured using Gen 5 software (Agilent Technologies), and endothelial microvessel formation was quantified by measuring the average microvessel length at each time point with Fiji (NIH ...
-
bioRxiv - Immunology 2020Quote: ... Cytospots were stained by May-Gruenwald Giemsa stain and mast cells were detected immunohistochemically (monoclonal mouse anti-human mast cell tryptase, Dako). Staining protocols and further details can be found in the supplementary material ...
-
bioRxiv - Cell Biology 2022Quote: ... MD and mutated at AKAP12’s activation-responsive sites (S/T to A mutations) using the QuikChange II® site-directed mutagenesis Kit (Stratagene, CA) as we described previously (54) ...
-
bioRxiv - Cell Biology 2020Quote: ... A gate pulse provided by a pulser (Berkley Nucleonics Corporation, 565) activated a MW generator (Agilent, E8257D) to output a MW pulse ...
-
bioRxiv - Immunology 2022Quote: ... heat-activated antigen retrieval of deparaffinized/dehydrated sections was performed using Target Retrieval Solution (Dako, Glostrup, Denmark). After the blocking of endogenous peroxidases using Peroxidase-Blocking Solution (Dako) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: OCR in human liver cells was measured using XFp Extracellular Flux Analyzers (Agilent Seahorse Biosciences). The cells were plated into XFp cell culture mini plates for 24 h ...
-
bioRxiv - Neuroscience 2023Quote: ... If nuclear staining was not necessary the slides were mounted with DAKO fluorescent mounting media (DAKO, s3023).
-
bioRxiv - Genomics 2020Quote: ... A corresponding screenshot showing read visualization when using the SureSelect Human All Exon V6 kit from Agilent is presented in Figure 5 ...
-
bioRxiv - Genetics 2022Quote: ... WES was performed using the SureSelect XT Human All Exon V6 kits (Agilent, Santa Clara, CA, USA). CLC Genomics Workbench version 7.0.5 (CLCBio ...
-
bioRxiv - Genomics 2021Quote: ... and the exonic regions were captured with Agilent SureSelect Human All Exon v7 Kit (Agilent, 5191-4005). Whole exome sequencing (WES ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The exome was captured using Agilent SureSelect Human All Exon V5 kit (Agilent, Santa Clara, CA, US) and sequenced in a HiSeq instrument (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pre-capture libraries containing exome sequences were captured using SureSelect Human All Exon V6 kit (Agilent). DNA concentration of the enriched sequencing libraries was measured with the Qubit 3.0 fluorometer dsDNA HS Assay (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: K125R and K125E mutations of human connexin 26 were prepared using the QuikChange II mutagenesis kit (Agilent) and the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of human tumors were stained with mouse anti-human CD68 (Dako) and goat anti-human TSP-4 (AF2390 ...
-
bioRxiv - Systems Biology 2019Quote: ... and human TTR (Dako) with standard curves of purified human RBP4 (72 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human universal RNA (Agilent) was used as a reference to standardise results between QPCR batches.
-
bioRxiv - Cancer Biology 2024Quote: ... Cell counting was conducted using an Agilent BioTek Cytation 5 (Agilent Technologies) imaging system with Gen5 software (Agilent Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene, La Jolla, CA). Quickchange II mutagenic primer sets were the following ...
-
bioRxiv - Microbiology 2021Quote: ... After deparaffinization, antigens were activated (121°C, 10 min) with Target Retrieval Solution pH6.0 (Dako Cytomation, Glostrup, Denmark), and endogenous HRP was inactivated by hydroperoxide treatment ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...