Labshake search
Citations for Agilent :
401 - 450 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: The Panx1 mutants were engineered with QuickChange II site-directed mutagenesis kit (Stratagene) according to the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2022Quote: ... The following secondary antibodies were used: 1:5000 goat anti-mouse immunoglobulin conjugated to HRP (RRID:AB_2617137, P0447, Agilent) and 1:5000 swine anti-rabbit immunoglobulin HRP conjucated (RRID:AB_2617141 ...
-
bioRxiv - Microbiology 2021Quote: ... Strips were washed and incubated for 1 hour with a horse radish peroxidase (HRP)-conjugated secondary immunoglobulin (DAKO). The strips were washed and immersed in citrate-EDTA before addition of the TMB substrate for 1 hour ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... as a primary antibody and polyclonal goat anti-rabbit Immunoglobulins conjugated with HRP (Agilent Dako, Santa Clara, CA) as a secondary antibody ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... as a primary antibody and polyclonal goat anti-rabbit Immunoglobulins conjugated with HRP (Agilent Dako, Santa Clara, CA) as a secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated for 1h at RT with the secondary antibody (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Dako; Polyclonal Goat Anti-Mouse Immunoglobulins/HRP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Flag-tagged wt and Ex19Del human EGFR constructs in the lentiviral VIRSP vector were generated by PCR with Herculase II Fusion DNA Polymerase (Agilent technologies) from EGFR WT (a gift from Matthew Meyerson ...
-
bioRxiv - Genetics 2020Quote: ... the exonic regions and flanking splice junctions of the genome were captured using the Clinical Research Exome kit (Agilent Technologies, Santa Clara, CA). Massively parallel (NextGen ...
-
bioRxiv - Cell Biology 2021Quote: ... Coding regions and intron/exon boundaries were sequenced on the Novogen platform (agilent v6, HiSeqX,) after enrichment with Agilent kits (Agilent Technologies, Wokingham, UK). Exomes data were analysed using a bioinformatics pipeline developed in-house using two modules ...
-
bioRxiv - Immunology 2022Quote: ... A second reverse transcription reaction was performed with MARS-seq RT2 primer and the Affinity Script cDNA Synthesis Kit (Agilent Technologies) followed by 1.5X AMPure XP bead cleanup ...
-
bioRxiv - Neuroscience 2020Quote: ... Cy3 labeling was performed with T7 RNA polymerase using Agilent Low RNA Input Linear Amplification Kit following manufacturer’s instructions (Agilent). The microarray was performed using the SuperPrint G3 Mouse GE 8×60K Microarray Kit (Agilent ...
-
The MKK3 MAPK cascade integrates temperature and after-ripening signals to modulate seed germinationbioRxiv - Plant Biology 2024Quote: ... Cyanine 3-labelled cRNA was synthesized from 150 ng RNA using the Low Input Quick Amp Labeling Kit (Agilent) and predicated using RNeasy Mini Kit (QIAGEN ...
-
bioRxiv - Cell Biology 2019Quote: The enrichment of chromatin regions was examined by qPCR on MX3000 (Agilent) using PerfeCTa SYBR green PCR mix (Quanta Biosciences) ...
-
bioRxiv - Plant Biology 2022Quote: ... the 5’ region was then amplified from pMDC43 with Pfu polymerase (Stratagene) and primers MDC43-for and MDC43-rev (Supplemental Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Chromatographic separation was carried out at 40°C using an Agilent 1260 Infinity II series UPLC (Agilent, Santa Clara, USA) over a 4 minute gradient elution (KNOWNS_AM190319.m ...
-
bioRxiv - Molecular Biology 2020Quote: ... and bound to 1.5 ml Calmodulin Affinity Resin (Agilent Technologies) overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... The elutions were incubated with calmodulin affinity resin (Agilent Technology) in buffer E plus 2 mM CaCl2 at 4 °C for 2 h and eluted in buffer E plus 10 mM EGTA.
-
bioRxiv - Cancer Biology 2021Quote: ... Multiple Affinity Removal System (MARS) HSA/IgG spin columns (Agilent) were used to deplete albumins and IgGs from blood samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sections were subjected to heat-induced antigen retrieval by incubation in a low pH buffer (Envision Flex TRS low pH (DAKO) for 20 min at 97°C (PT-Link ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was first performed with high or low pH buffer depending on the primary antibody (CC1m, Roche or low pH antigen retrieval buffer, Dako), endogenous peroxidase was blocked (peroxide hydrogen at 3% ...
-
bioRxiv - Immunology 2022Quote: For the analysis of Fcγ-receptor binding PE-Streptavidin (Agilent Technologies, CA, USA) was coupled to recombinant and biotinylated human FcγR2A ...
-
bioRxiv - Immunology 2021Quote: ... Molecular mutants were prepared using the QuikChange II XL site-directed mutagenesis kit (Stratagene). The mCherry plasmid was previously described(Pauker ...
-
bioRxiv - Cell Biology 2019Quote: ... Site directed mutagenesis for CA14 (Thr199Ile) was carried out using SDM II kit (Agilent) using primers listed in Supplementary table 1 ...
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutants for HPF1 were generated using the Quikchange II kit from Agilent Technologies according to manufacturer’s specifications ...
-
bioRxiv - Biophysics 2021Quote: ... SaFtsZ single-residue mutants were prepared using QuikChange II Site-Directed Mutagenesis Kit (Agilent) with primers listed in S4 Table ...
-
bioRxiv - Neuroscience 2020Quote: ... 2013) using the QuikChange II XL kit according to the manufacturer’s instructions (Stratagene, CA). The homologous mutation was also performed in Nav1.2 (F385S)(Rush et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutations were introduced by using the QuikChange II site-directed mutagenesis kit (Agilent Technologies). Sequences encoding Kras and SHP2 sgRNAs (Supplementary Table x ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... We used pcDNA3.1-PPARγ2 and the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... mutations were made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200521) in an entry vector ...
-
bioRxiv - Microbiology 2021Quote: ... was obtained by using a modified Quick-Change II Site-Directed Mutagenesis kit (Agilent). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... was achieved by site-directed mutagenesis using QuickChange II Site-directed mutagenesis kit (Agilent) as described in [25].
-
bioRxiv - Cell Biology 2021Quote: ... Point mutations were generated using QuikChange II site-directed mutagenesis kits (Agilent, Cat# 200521) according to the manufacturers protocols in pSKS40 and pSKS41 to generate α-synuclein(A53T)-mClover2 (pSKS42) ...
-
bioRxiv - Biochemistry 2022Quote: ... Y269A APE1 mutants were generated using the QuikChange II site-directed mutagenesis kit (Agilent). All proteins were expressed in One Shot BL21(DE3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... CDK2 mutants were generated using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) siControl and siIRAK4 were purchased from Horizon Discovery and transfected into human AML samples using Amaxa Nucleofector Kit T (Lonza ...
-
bioRxiv - Biochemistry 2021Quote: ... All mutations were generated with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... For mutation of single nucleotides we employed QuikChange II Site-directed mutagenesis kit (Agilent) or NEBase Changer–Kit (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... Catalytic mutants were generated by site directed mutagenesis (Agilent Quik Change II Mutagenesis Kit). Primers used ...
-
bioRxiv - Genetics 2020Quote: ... and L191H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). The pcDNA3-Myc-Exosc5 (pAC3519 ...
-
bioRxiv - Genetics 2020Quote: ... and L206H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). All plasmids were sequenced to ensure the presence of desired mutations and absence of any other mutations.
-
bioRxiv - Microbiology 2020Quote: ... All point mutations were made using Site Directed Mutagenesis QuikChange II Kit (Agilent; 200524).
-
bioRxiv - Immunology 2019Quote: ... Point mutations were generated using the QuickChange II site-directed mutagenesis kit (Agilent, 200523) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Mutations were made in the CREAX reporter using the Quickchange II Kit (Stratagene, 200518). Details of the mutations are shown in supplementary table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA TseV2 and pBRA TseV3 plasmids as templates ...
-
bioRxiv - Neuroscience 2021Quote: ... Ric S73N and Q117L mutants were generated using the QuikChange II mutagenesis kit (Stratagene). YFP- and CFP-dDAT and Ric constructs were generated by subcloning into pEYFP-C1 and pECFP-C1 vectors ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA SP-Tae5STM (STM14_0336 ...
-
bioRxiv - Genetics 2021Quote: ... a final round of random mutagenesis was performed using the GeneMorph II kit (Agilent). Yeast plasmids are available through Addgene (https://www.addgene.org/158585/ ...
-
bioRxiv - Genetics 2020Quote: ... Point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). All plasmid sequences were verified by sequencing before use.
-
bioRxiv - Molecular Biology 2021Quote: ... The H188A mutation was introduced by QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) with the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site-directed mutagenesis using QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was performed to create the FLOT2 G2A and FLOT2 Y163F mutants ...
-
bioRxiv - Neuroscience 2022Quote: ... site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with primer set:SMH1607 forward GAAGACCTGAGCCAGAAGGAGGCAAGCGACCTGCTCAACACCCAG and SMH1608 reverse CTGGGTGTTGAGCAGGTCGCTTGCCTCCTTCTGGCTCAGGTCTTC ...