Labshake search
Citations for Agilent :
201 - 250 of 631 citations for Galectin 7 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and human α1 antitrypsin (diluted 1:1000; Dako, Carpinteria, CA, USA). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... with primary anti-human antibodies against Melan-A (clone A103; Dako), S100 (IR504 ...
-
bioRxiv - Cell Biology 2023Quote: Rabbit anti-human C3c (F0201) polyclonal Ab was obtained from Agilent Dako (Santa Clara ...
-
bioRxiv - Genetics 2023Quote: ... The Agilent SureSelect Human All Exon V6 Kit (Agilent Technologies, USA) was applied for exon capture ...
-
bioRxiv - Cancer Biology 2021Quote: Immunohistochemical staining of formalin-fixed, paraffin-embedded xenografts was performed after antigen retrieval (120°C, 7 min at pH9) and peroxidase blocking (Dako) using the UltraVision LP detection system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All liver RNA samples had integrity numbers (RIN) ≥ 7 as verified with the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany). A260/A280 were ≥ 1.8 as verified with Thermo Scientific™ NanoDrop 2000 spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... immunohistochemical staining was done with an antibody against human Ki67 (M7240, DAKO). 10 μm-thick tumor cryosections were fixed with a 4% PFA solution ...
-
bioRxiv - Genomics 2020Quote: ... pre-capture PCR and SureSelectXT Human All Exon V5+UTR baits (Agilent). Post-capture fragments were amplified by PCR ...
-
bioRxiv - Genomics 2020Quote: ... Lysates and positive controls (Human Universal Reference RNA - uhrRNA (Agilent Cat# 740000), and Human Brain Total RNA brRNA (ThermoFisher AM7962)) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human KIF4A was amplified using Pfu hot start turbo polymerase (Agilent Technologies). Mammalian expression constructs were made in pcDNA5/FRT/TO (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... The antibodies used were the polyclonal rabbit anti-human β2M antibody (Dako) (used at 1/1000) ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies used in IHC assays include: mouse-anti-human CD3 (Dako, F7.2.38), rabbit-anti-human Granzyme B (eBiosciences ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... Hybridization to SurePrint G3 Human Gene Expression 8×60K Microarrays (Agilent Technologies) was performed with the Gene Expression Hybridization Kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... Akata cells were treated with polyclonal rabbit anti-human IgG (Agilent, A0423) at 7.5 μg/mL for 8 or 24 h ...
-
bioRxiv - Genetics 2021Quote: ... we used the i) Agilent SureSelectXT Human All Exon V6 (Agilent Technologies), ii ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections were incubated with rabbit anti-human PGP 9.5 (DAKO 1:100) overnight at 4°C.
-
bioRxiv - Cancer Biology 2022Quote: The human CDK1 S39A mutation was introduced using Quickchange (Agilent, cat #600670) using specific primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The exons were captured using SureSelect XT2 Human All Exon V6 (Agilent), and sequenced by paired-end 75 bp sequencing on HiSeq4000 (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... GFAP was detected with polyclonal rabbit-anti human GFAP (1:500, Agilent) and donkey anti-rabbit IgG AF55 detection (1:500 ...
-
bioRxiv - Immunology 2019Quote: ... Sections were incubated with mouse anti-human CD68 (#M0814, Clone KP1, Dako) antibody (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-human PECAM-1 (CD31) (M0823, Agilent Dako, Santa Clara, CA), GAPDH mouse anti-human (10R-G109b ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-human PECAM-1 (CD31) (M0823, Agilent Dako, Santa Clara, CA), GAPDH mouse anti-human (10R-G109b ...
-
bioRxiv - Immunology 2020Quote: ... or rabbit anti-human IgA/HRP (Dako: cat. P0216, 1:5’000 dilution). Assays were developed by addition of 3,3’,5,5’-Tetramethylbenzidine (TMB ...
-
bioRxiv - Microbiology 2020Quote: ... Bound antibodies were detected using HRP-labelled rabbit anti–human IgG (Dako) or anti-hamster IgG and TMB (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: Immunohistochemistry on human (antigen retrieval by Target Retrieval Solution pH6.0 (DAKO #S1699)) and mouse fetal tissue was performed using Autostainer (Dako ...
-
bioRxiv - Genomics 2021Quote: ... MAQCA is the Quantitative PCR Human Reference Total RNA (#750500, Agilent technologies), extracted from cell lines representing different human tissues ...
-
bioRxiv - Immunology 2020Quote: ... Monoclonal mouse IgG1 anti-human CD32 (clone KB61) was purchased from Dako, Santa Clara ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The NCBI BioProject database accession number is PRJNA600674 ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The Gene Expression Omnibus accession number is PRJNA600674 ...