Labshake search
Citations for Agilent :
1 - 50 of 8387 citations for Estrone 3 Sulfate E1S ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Physiology 2023Quote: ... Plates were read according to manufacturer’s instructions using the Cytation 3 plate reader (Agilent) with Gen5 software (v2.04).
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Immunology 2020Quote: ... These genes were cloned into an Adenovirus type 5 replication-defective E1/E3 deleted vector using the Ad-Easy Adenoviral Vector System (Agilent). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Neuroscience 2023Quote: ... Fluorescence of plasma samples was directly measured using a Take 3 Microvolume Plate (Agilent), measured using an Agilent Cytation 7 (Excitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2020Quote: ... Calu-3 in Seahorse plates were switched to Seahorse XF base media (Agilent 103334-100) supplemented with 10 mM glucose (Fisher BP350) ...
-
bioRxiv - Microbiology 2022Quote: ... Images were acquired by Cytation 3 imaging plate reader (Agilent Technologies, Santa Clara, CA, USA), cell nuclei and LCMV NP expression in infected cells were detected by Gen5 software (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-VWF (A0082, 1:1000) and rabbit anti-VWF-HRP (P0226, 1:8000) used for sandwich ELISA were purchased from Dako, sheep anti-VWF (ab11713 ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... The library preparation and sequence capture were done as described in the SureSelectXT2 Target Enrichment System for Illumina Paired-End Multiplexed Sequencing manual (Agilent, Version: E1, June 2015). The desired fragments were captured with Dynabeads (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2019Quote: ... The plate was subjected to a temperature gradient for 3 minutes in a PCR machine (Agilent SureCycler 8800), followed by 3 minutes at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... into 1 mL 96 well plates and sealed with a silicone plate mat (Agilent, Santa Clara, CA). Aliquots of 12 samples from each row were combined into pools ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2021Quote: HMECs were cultured at a density of 3 x 104 cells/well in 24-well Seahorse XFe24 plates (Agilent) and incubated at 37 °C under a humidified 5% CO2 atmosphere overnight in the presence or absence of DMF ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was then exposed to a temperature gradient for 3 min in a PCR machine (Agilent SureCycler 8800), followed by 3 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Myotubes grown on 24 well plates were fasted for 3 h in glucose-free DMEM (103575-100, Agilent, USA). Incubation with 100 nM insulin (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2021Quote: ... Compound incubated plates and basal plates were then washed with assay media (Seahorse XF DMEM assay media kit (Agilent; #103575-100), 10 mM glucose ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Microbiology 2023Quote: Log phase cultures of cells grown without inducer were diluted to an OD600 of 0.05 and grown in 96-well plates for 24 h at 30°C with constant shaking on a BioTek Cytation 1 plate reader (Agilent), measuring the absorbance at 600 nm every 30 min for three technical replicates for each strain ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Synthetic Biology 2023Quote: ... for incubation in a Cytation 1 multi-mode plate reader (Agilent BioTek). Plate lids were treated with 10% Triton X-100 in ethanol to prevent fogging (73) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cleared lysates were loaded on wells of 96-well single-use filter micro-plates with 3 µm glass fibers and 25 µm polyethylene membranes (Agilent, 204495-100) containing the HB95 cross-linked beads ...
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... seeded (25,000-50,000 cells/well) on Matrigel coated test plates (Extracellular Flux Assay Kit, Agilent) and cultured 4 days in maturation medium prior to measurement ...
-
bioRxiv - Genomics 2021Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for an additional 20 min allowing cells to settle on the pre-dispensed gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 3100 OFFGEL Fractionator and the OFFGEL Kit pH 3-10 (Agilent Technologies, Santa Clara, CA) was used following a 24-well set up ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were sealed using a PlateLoc plate sealer (Agilent) with optical clear seal ...
-
bioRxiv - Immunology 2022Quote: Naive CD3+ T cells were placed on PLL-coated Seahorse Bioanalyzer XFp culture plates (3 × 105 cells/well) with Seahorse XF RPMI Assay Media (RPMI Medium, pH 7.4, 103576-100; Agilent Technologies, Santa Clara, CA, USA), supplemented with 10 mM glucose (103577-100 ...
-
bioRxiv - Neuroscience 2023Quote: ... 50,000 cells per well were plated after 3 days of induction in a specialized Seahorse analyzer 96-well plate (Agilent, cat. no. 103774-100). Cells were washed in PBS once and incubated in a hypoxic chamber following the manufacturer’s procedure ...
-
bioRxiv - Neuroscience 2023Quote: ... 50,000 cells per well were plated after 3 days of induction in a specialized Seahorse analyzer 96-well plate (Agilent, cat. no. 103774-100). 10-12 day old i3Neurons were treated with 5 nM vincristine ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was recorded for 1 h on a Biotek Synergy HTX plate reader (Agilent) with excitation and emission filters of wavelength 485/20 and 528/20 nm ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA quality was confirmed as RIN 3 7.5 via Bioanalyzer RNA 6000 Pico kit (Agilent, 5067-1514) and RNA was quantified via Qubit RNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...