Labshake search
Citations for Agilent :
151 - 200 of 373 citations for Diphtheria Toxin CRM197 Mutant since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... All point mutants used were generated using the standard Quikchange protocols (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Synthetic Biology 2020Quote: ... Oligo pool encoding the de novo designs and the point mutant library were ordered from Agilent Technologies ...
-
bioRxiv - Pathology 2021Quote: ... Asic2b N416A and Asic2b N443A mutants were generated using Quickchange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Wobble mutant cell lines were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c ...
-
bioRxiv - Immunology 2021Quote: ... The hHVEM mutant library was generated using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Full length of WT mHVEM and mutants were cloned into pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We generated mutant libraries of each gene via random mutagenesis with the Mutazyme II kit (Agilent), using 200ng of DNA template and eight cycles of mutagenic PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... MAP2c phosphomimetic mutant S426E was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) and mutagenized primers (Table S5) ...
-
bioRxiv - Neuroscience 2021Quote: ... N2081D and G2385R mutant GFP-tagged LRRK2 constructs were generated by site-directed mutagenesis (QuikChange, Stratagene), and identity of all constructs verified by sequencing of the entire coding region ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Biophysics 2023Quote: ... All point mutants used were generated using the standard Quikchange protocols (Agilent Technologies, Santa Clara, CA). Expected construct sequences were confirmed using Sanger sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2023Quote: ... The MLS-TFEB mutant was generated using the Quikchange XL site-directed mutagenesis kit (200521, Agilent). The ΔMTS mutant was generated by cloning a truncated sequence of TFEB in the pcDNA 3.1 FLAG backbone (121416 ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-K-RasG12V H95C and GFP-H-RasG12V Q95H mutants were designed and ordered from Agilent QuikChange Primer Design (Agilent ...
-
bioRxiv - Biophysics 2024Quote: ... Mutants of BOSS and dROS1 were generated by site-directed mutagenesis using QuickChange Kit (Agilent Technologies). Proteins were purified from the medium (Ex-Cell405 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ΔN and R764Q mutants of SMARCAL1 were introduced by site-directed mutagenesis using Quikchange (Agilent). For FANCM complementation assays ...
-
bioRxiv - Developmental Biology 2020Quote: ... CDB0573K: http://www2.clst.riken.jp/arg/mutant%20mice%20list.html) was constructed from a 129SVJ genomic clone (STRATAGENE, CA). Exon 1 of the Cnot9 locus was targeted and replaced by LacZ and neomycin resistance gene by electroporating TT2 ES cells (Yagi et al. ...
-
bioRxiv - Cancer Biology 2019Quote: Site-directed mutagenesis to generate the mutant RAS clones was performed with a QuikChange mutagenesis kit (Stratagene) and the primers for amino acid 180 site mutation of KRAS4A are CAGCAAAGAAGAAAAGACTCCTGGCAGTGTGAAAATT and AATTTTCACACTGCCAGGAGTCTTTTCTTCTTTGCTG.
-
bioRxiv - Molecular Biology 2019Quote: ... Point mutants in the yeast Ddi1 sequence were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Entry clones bearing domain deletions ...
-
bioRxiv - Cell Biology 2019Quote: ... The catalytically inactive Pep4 mutant was generated by using a modified version of the QuikChange protocol (Agilent). The construct VGc448 was used as template and the single primer 5’AAAACTTCAAGGTTATTTTGAAGACTGGATCCTCAAACCTTTGGGTTCCAAG was used to introduce the point mutation D109K and a diagnostic restriction site ...
-
bioRxiv - Cell Biology 2019Quote: ... Point mutants were made by site-directed mutagenesis using a QuikChange Site-Directed Mutagenesis kit (Stratagene, CA) (Yoshida et al. ...
-
bioRxiv - Cell Biology 2019Quote: The CH mutant was made from the CB construct by site-directed mutagenesis (Quikchange II XL, Agilent) (fwd ...
-
bioRxiv - Neuroscience 2019Quote: ... Single cysteine mutants (M173C, S235C, V304C and I367C) were generated using a QuickChange mutagenesis kit (Agilent Technologies).
-
bioRxiv - Biochemistry 2020Quote: ... Q63R and L75G MA mutant constructs were generated using a QuickChange XL site-directed mutagenesis kit (Stratagene). Forward and reverse primers (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... Fragments and mutant forms of BICD2 were produced using QuickChange Lighting Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s instructions using the following primers and the appropriate reverse complements:
-
bioRxiv - Biochemistry 2020Quote: ... All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, #200523). Lipofectamine 3000 from Thermo Scientific was used for transfection of HEK293T cells.
-
bioRxiv - Synthetic Biology 2021Quote: Scanning mutant libraries were constructed using saturation mutagenesis using the QuikChange HT Protein Engineering System from Agilent following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... The K186A mutant (AAG>GCG) was generated by site-directed mutagenesis employing PfuTurbo DNA polymerase (Agilent Technologies). All constructs were verified by DNA sequencing (Eurofins Genomics) ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutants were generated using the QuikChange II site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PBP2 D515N and C551S mutants were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). Cloned vector was then transformed into BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: Vpu mutants were generated using PCR-based Quick-change site-directed mutagenesis as per standard protocols (Agilent).The plasmids encoding WT Vpu and Vpu mutants were generated by insertion of the corresponding Vpu fragments from pNL 4-3 ADA proviral constructs into the pCGCG-IRES-GFP plasmid ...
-
bioRxiv - Molecular Biology 2019Quote: CbAgo double mutant (D541A, D611A) was generated using an adapted Quick Directed Mutagenesis Kit instruction manual (Stratagene). The primers were designed using the web-based program primerX (http://bioinformatics.org/primerx).
-
bioRxiv - Immunology 2020Quote: Viral mutants were generated by site-directed mutagenesis using the Quikchange II Site-directed mutagenesis kit (Agilent) with forward and reverse primers specific for each mutation (Key Resources Table) ...
-
bioRxiv - Microbiology 2019Quote: ... point mutants were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... B35SSB mutants were obtained by direct mutagenesis using different oligonucleotides (Table S1) and Pfu DNA Polymerase (Agilent). The expression vectors were used to transform E ...
-
Gatekeeper helix activates Golgi SM protein Sly1 and directly mediates close-range vesicle tetheringbioRxiv - Cell Biology 2020Quote: ... a library of SLY1* mutant alleles was constructed using the GeneMorph II Random Mutagenesis Kit (Agilent #200550). The SLY1 open reading frame was amplified using the “medium mutation rate” PCR protocol ...
-
bioRxiv - Microbiology 2021Quote: ADAP1 and KRAS point mutants were generated using QuikChange II XL Site-Directed Mutagenesis kit (Agilent, 200522) per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... All mutant genes were constructed by polymerase chain reactions using a QuickChange Site-Directed Mutagenesis kit (Stratagene) and primers (Table S1) ...
-
bioRxiv - Biochemistry 2021Quote: Arpin WT and mutants W195D and I199D/M200D were obtained using the QuikChange Lightning mutagenesis kit (Agilent). Full length ORFs encoding Arpin WT and mutants W195D and I199D/M200D were cloned in our custom-made plasmid (MXS EF1Flag Blue2 SV40pA PGK Blasti bGHpA ...
-
bioRxiv - Molecular Biology 2020Quote: ... and their respective point mutants were overexpressed in Escherichia coli BL-21 or TKB1 competent cells (Stratagene) (100 mL Luria Bertani (LB ...
-
bioRxiv - Developmental Biology 2022Quote: ... The mutant construct for Gpdh was made using QuickChange Lighting Site-Directed Mutagenesis kit (Agilent Technologies #210518). The wildtype construct was used a template for mutagenesis ...
-
bioRxiv - Cell Biology 2022Quote: ... We generated the 873-1159-Citrine ΔNLS mutant using site-directed mutagenesis (QuikChange II Kit, Agilent Technologies) using the distal plasmid as a template ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Microbiology 2022Quote: ... The mVSGG1954 mutant S321A was generated by site-directed mutagenesis using the QuikChange Lightening kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutant constructs (mut_GLA_FLAG/pCR3.1) were prepared by site-directed mutagenesis (Site-Directed Mutagenesis Kits, QuickChange II, Agilent) and selected by sequencing.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The mutant M1237I spike related constructs were generated using the QuikChange II site-directed mutagenesis kit (Agilent) with the primer set of S-M1237I-F ...
-
bioRxiv - Molecular Biology 2022Quote: ... The TRPM2 and TRPML1 mutant forms were produced using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... I5S mutant (mt) RIIα-mTb-V5 plasmid was generated by site directed mutagenesis (QuikChange II XL, Agilent) based on the wild type (WT ...
-
bioRxiv - Cell Biology 2023Quote: ... The TRPV4 mutant constructs were prepared using a QuickChange® Multi Site-Directed a genesis Kit (Stratagene). To obtain truncated TRPV4 (aa 718–871) ...
-
bioRxiv - Microbiology 2023Quote: ... All of the A28L mutant constructs were prepared using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions and confirmed by sequencing (Genomics Inc. ...
-
bioRxiv - Biochemistry 2023Quote: ... Generation of a donor vector for the Arg357Cys mutant was performed using the QuikChange mutagenesis kit (Agilent). Briefly ...