Labshake search
Citations for Agilent :
1 - 50 of 2006 citations for Coiled Coil Domain Containing 28B CCDC28B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Biophysics 2020Quote: ... A thrombin site was introduced between the 6xHis-tag and the coiled-coil using the QuikChange Lightning mutagenesis kit (Agilent, Santa Clara, USA). Sequences of the products were confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...
-
bioRxiv - Neuroscience 2020Quote: ... equipped with a 400 mT/m gradient coil (Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... The coil was placed in the 9.4 Tesla apparatus (Agilent Varian 9.4/160/ASR ...
-
bioRxiv - Biochemistry 2022Quote: ... constructs containing DNA encoding 8X-His-tagged CHI-domain-containing proteins were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent) for recombinant protein expression ...
-
bioRxiv - Neuroscience 2022Quote: ... fitted with a 40 G/cm gradient coil (Agilent, 205/120 mm) and a Birdcage receive/transmit RF coil (Rapid Biomedical ...
-
bioRxiv - Neuroscience 2021Quote: ... compared to a commercially available 40-mm millipede (MP40) volume coil (Agilent, Palo Alto, CA, USA), has been reported previously.35
-
bioRxiv - Cell Biology 2021Quote: The CC and ORD domains of ORP5 or the TM domain of ORP8 were deleted using site-directed mutagenesis (Quickchange II-XL, Stratagene) to generate EGFP-ORP5ΔCC and EGFP-ORP5ΔORD or EGFP-ORP8ΔTM.
-
bioRxiv - Cancer Biology 2021Quote: ... W503F (PBD, polo-box domain 1) and H629A, K631M (PBD, polo-box domain 2) were generated by site-directed mutagenesis (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Images were performed using a 35 mm Litzcage coil (Doty Scientific, Inc) on a 7T horizontal magnet (Agilent ASR 310) and (Bruker Biospin ...
-
bioRxiv - Cancer Biology 2021Quote: ... suspended in saline in 12 mm glass vials and 2H-MR spectra acquired using a 16 mm 2H single loop surface coil (DOTY Scientific) at a Varian 14.1T vertical MR scanner (Agilent Technologies). A pulse-acquire sequence (TR=260ms ...
-
bioRxiv - Biochemistry 2019Quote: ... The ASK1 SAM domain was amplified from the MegaMan Transcriptome library (Agilent). Constructs comprising ASK2 and ASK3 were amplified from Addgene plasmids (#69727 and #69728 ...
-
bioRxiv - Neuroscience 2020Quote: ... MR scans were performed using a quadrature surface RF coil and a 9.4 T/31 cm magnet (Magnex Scientific, Abingdon, UK) interfaced to an Agilent console (Agilent, Inc., Palo Alto, CA, USA). A cerebellar volume-of-interest (VOI ...
-
bioRxiv - Cancer Biology 2022Quote: Coordinates for MRI-guided biopsy were determined by a fiducial markers attached to the whole-body volume transmit coil and VnmrJ software (Agilent Technologies, Inc., Santa Clara, CA)[15] (Fig ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... was performed on an Armen Instrument (AlphaCrom, Rheinfelden, Switzerland) with coil volume 100 mL connected to a Varian pump model 210 (Agilent technologies, Santa Clara, CA, USA), a Varian 218 UV detector and a Varian fraction collector (model 704) ...
-
bioRxiv - Bioengineering 2020Quote: ... a high-power resistor of 1 Ω was placed in series with the coils and voltage drop across the resistor was observed with an oscilloscope (Agilent Technologies, Santa Clara, CA) during PEMF exposure period ...
-
bioRxiv - Neuroscience 2022Quote: ... equipped with a 12 cm internal diameter gradient coil insert (400 mT/m, 120 μs) and a DirectDrive console interface (Agilent Technologies, Palo Alto, CA, USA). Radiofrequency transmission/reception was achieved using a homebuilt three-channel surface coil ...
-
bioRxiv - Biochemistry 2024Quote: ... K101N mutations in pBAD24 using the GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) with the manufacturer’s protocol and the following primers ...
-
bioRxiv - Biophysics 2023Quote: ... an antibody mixture containing 1-part DAKO (Agilent, Cat#: S080983-2) and 4-parts goat serum was mixed to create a desired antibody dilution:
-
bioRxiv - Immunology 2019Quote: ... Additional mutations within the thioester domain were introduced by QuickChange site-directed mutagenesis (Stratagene). LRIM1 and APL1C were subcloned into the pFastbac-Dual vector with C-terminal 6×His tag on APL1C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Error-prone PCR was performed using the GeneMorph II EZClone Domain Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: The smcR mutant alleles were created using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) as per the company protocol targeting the smcR gene encoded on plasmid pJN22 ...
-
bioRxiv - Neuroscience 2019Quote: ... the secondary antibody containing HRP rabbit/mouse serum (DAKO EnVision Detection Systems) was added and incubated for 1 hour ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: Libraries of ProQ mutants were generated by using GeneMorph II EZClone Domain Mutagenesis Kit (Agilent). As template ...
-
bioRxiv - Cancer Biology 2022Quote: ... EZH2’s SET domain deletion was generated by a site-directed mutagenesis kit (Agilent, 200521). All plasmids were verified by Sanger sequencing ...
-
bioRxiv - Immunology 2022Quote: ... the membrane was incubated in secondary antibody solutions (TBS containing 0.1 % Tween-20 and 5 % BSA, HRP-conjugated secondary antibodies (1:5000, Dako)) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... the PH domain in HA-ORP5wt was deleted by site-directed mutagenesis (Quickchange II-XL, Stratagene) as in (Galmes et al. ...
-
bioRxiv - Immunology 2020Quote: ... The RBD domain of SARS-CoV-2 S was biotinylated and tetramerized with streptavidin-APC (Agilent). The APC decoy reagent was generated by conjugating SA-APC to Dylight 755 using a DyLight 755 antibody labeling kit (ThermoFisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... Mutations were introduced into the CCT domain by site-directed mutagenesis (Pfu Turbo DNA polymerase, Agilent) and all the constructs were verified by sequencing and subsequently transformed into BL21-CodonPlus (DE3)-RIL Competent Cells for protein production.
-
bioRxiv - Microbiology 2023Quote: ... Blocking solution was washed out with PBS containing 0.05% Triton X-100 and samples were stained with primary antibody diluted in Dako antibody diluent (Agilent Technologies). Primary antibodies and dilutions used were as follows ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Primary anti-CD31 antibody in Tris-HCl buffer containing stabilizing protein and 0.015 mol/L sodium azide (Dako Antibody Diluent, Dako, Glostrup, Denmark) were then added to the slides ...
-
bioRxiv - Genetics 2021Quote: Mutagenesis of the sequence encoding Sir3464-728 using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent, 200552-5) was performed by PCR on 9,5 µg of pACT2-SIR3464-728 with 20 cycles of amplification to allow low mutation rate ...
-
bioRxiv - Microbiology 2021Quote: ... Mutageneses of the VqmAPhage and VqmAVc DBDs was accomplished using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The AR DBD domain DNA fragment was amplified using Herculase II Fusion DNA Polymerase (Agilent Technologies; cat. 600677) with 36 cycles and annealing at 63.5°C ...
-
bioRxiv - Cell Biology 2022Quote: ... organoids were incubated in blocking buffer containing primary antibody (rabbit anti-lysozyme 1:800, Dako #A0099) overnight at 4°C ...
-
bioRxiv - Biophysics 2023Quote: ... A non-cleavable T855G mutant of this Lphn3 GAIN domain fusion protein was generated using QuikChange II XL (Agilent) site-directed mutagenesis with primers 5’-ATG CAG CTG TAA TCA CCT GGG CAA CTT TGC TGT CCT GAT G -3’ and 5’-CAT CAG GAC AGC AAA GTT GCC CAG GTG ATT ACA GCT GCA T -3’.
-
bioRxiv - Biochemistry 2023Quote: ... GST and GST-fused CBS-pair domain of murine CNNM2 were expressed in transformed BL21 (DE3) cells (Stratagene, CA). Bacterial cells were lysed by sonication in ice-cold PBS containing 1% Triton X-100 and protease inhibitor phenylmethylsulfonyl fluoride (Sigma–Aldrich) ...
-
bioRxiv - Biophysics 2019Quote: Human CAMSAP1 residues 1474-1613 encompassing the CKK domain (HsCKK) were cloned into pET28a vector and expressed in BL21(DE3) cells (Stratagene). Following purification via immobilized metal-affinity chromatography (IMAC ...
-
bioRxiv - Immunology 2019Quote: ... mutant with Cys20 to Arg and Cys23 to Ser mutations in the RING1 domain was made by site-directed mutagenesis using Quickchange (Stratagene) with primers CCGCTGGTGTCTAGAAAGCTCAGTCTTGGGGAGTAC and GTACTCCCCAAGACTGAGCTTTCTAGACACCAGCGG ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene) using the primer sequences ...
-
bioRxiv - Cell Biology 2020Quote: ... The cytoplasmic and KASH domains of the mini-nesprin constructs were obtained from a previous publication.22 The mutant domain was made from this construct by site-directed mutagenesis (Quikchange II XL, Agilent). The DN-KASH construct was made by ligation after digestion by ClaI of a PCR product from the mini-nesprin construct ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Biophysics 2020Quote: The deletion construct containing the catalytic domain and the interdomain linker (CreCat, residues 127-343) was prepared using QuikChange Site-Directed Mutagenesis Kit (Agilent) from a pET21A vector (Novagen ...
-
bioRxiv - Biochemistry 2019Quote: Mutants were generated for each domain by introducing single point mutations using the Quick change site-directed mutagenesis kit (Stratagene). The primer sequences used for mutagenesis are listed in the supplementary S1 Table ...
-
bioRxiv - Genetics 2021Quote: ... while the domain deletions were constructs from initial cDNA constructs using the site-directed mutagenesis kit QuikChange™ (Agilent Technologies) and adequate primers (Supplemental Table S4) ...
-
bioRxiv - Cell Biology 2020Quote: ... including glutathione S-transferase (GST)-NEPH1 cytoplasmic domain (CD) and GST-NEPHRIN CD were expressed and purified from Escherichia coli BL21 cells (Stratagene). Purified phosphorylated GST-NEPH1 was expressed and purified from TKB1 cells (Stratagene) ...
-
bioRxiv - Biochemistry 2021Quote: ... The kinase domain c-Abl mutations were introduced into the human c-Abl kinase domain by site-directed mutagenesis using the QuikChange II kit (Agilent) and verified by DNA sequencing.
-
bioRxiv - Cancer Biology 2021Quote: ... first an AgeI cut-site was knocked into the pcDNA3.1-Myoferlin-HA plasmid immediately prior to the transmembrane domain by site-directed mutagenesis (Agilent: 210518). Second ...
-
bioRxiv - Genomics 2020Quote: ... The indicated domain deletions and point mutations were generated by site-directed mutagenesis using the QuickChange Lightning Site-Directed Mutagenesis kit (Agilent). For CD34+ HSPC cultures ...