Labshake search
Citations for Agilent :
401 - 450 of 2474 citations for Ciprofloxacin Hcl 100 Ug Ml In Methanol 2 3 Carboxyl 13C3 99%; Quinoline 15N 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... CD3 (DAKO, clone A0542, 1:100 dil), F4/80 (BioRad ...
-
The Batten disease protein CLN3 is important for stress granules dynamics and translational activitybioRxiv - Molecular Biology 2022Quote: ... and 10 mM glucose (Agilent # 103681-100). Oligomycin and FCCP were reconstituted to concentrations of 10 μM and 5 μM ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 mM pyruvate (Agilent Technologies, 1003578-100) and 2 mM glutamine (Agilent Technologies ...
-
bioRxiv - Pathology 2022Quote: ... rabbit anti-mouse HRP (1/100, Dako), goat anti-rabbit Alexa Fluor 488 (1/200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit-anti-S100B (1:100, Dako, Z0311); rabbit-anti-βIV tubulin (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: Mito Fuel Flex Test (#10360-100, Agilent) was performed according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 mM pyruvate (#103578-100, Agilent), and a final volume of 180 μl assay media was added to cells ...
-
bioRxiv - Immunology 2019Quote: ... CD8 (Agilent Technologies, C8/144B, 1:100) and Sema3A (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... and Beta-Amyloid (Dako, M0872, 1:100) were diluted in Bright Diluent (ImmunoLogic ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Cancer Biology 2020Quote: ... 1 mM pyruvate (#103578-100, Agilent Technologies) and 2 mM glutamine (#103579-100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Agilent Seahorse XFe96 cartridge (Agilent, 102416-100) was hydrated with 200 μl of calibrant solution (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: Cell Mito Stress Test (Agilent, #103015-100):
-
bioRxiv - Genomics 2023Quote: ... and 10mM glucose (103577-100, Agilent Technologies) and incubated in the same medium for 1 hour at 37°C in a non-CO2 incubator ...
-
bioRxiv - Biochemistry 2023Quote: ... DMEM XF base media (Agilent 102353-100) containing 1 mM sodium pyruvate (Sigma S8636-100ML) ...
-
bioRxiv - Cell Biology 2023Quote: ... The Mito Stress Test (103015-100, Agilent) was performed the following day ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10 mM glucose (Agilent, 103577-100). Cells were then placed into a non-CO2 humidified incubator at 37°C for 60 min ...
-
bioRxiv - Neuroscience 2023Quote: ... pH 7.4 (Agilent, cat. no 103575-100) further supplemented with 1 mM L-glutamine (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 2.1 mm × 100 mm column (Agilent Technologies), starting with 90% B for 2 min ...
-
bioRxiv - Physiology 2024Quote: ... or ATP production medium (Agilent 103575-100). Glycolytic activity was assessed by measurement of extracellular acidification rate on a Seahorse XFe96 instrument (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: ... in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... in XF RPMI medium (Agilent #103576-100) supplemented with 1mM Sodium Pyruvate ...
-
bioRxiv - Cell Biology 2024Quote: ... (Agilent, #103193-100; adjusted to pH 7.4) with 10 mM glucose (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... α-smooth muscle actin (1:100, Dako #M0851), and H3K4me3 (1:600 ...
-
bioRxiv - Cell Biology 2023Quote: ... the Seahorse Sensor Cartridge (#102416-100, Agilent) was hydrated in Seahorse XF Calibrant (#102416-100 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and PECAM (M0823, DAKO, 1:100, RRID:AB_2114471). In the enzyme-antibody method ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed twice and changed into Seahorse XF DMEM or RPMI medium (Agilent Technologies, 103680-100, 103681-100) containing 10 mM glucose ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-PMEL (Agilent Technologies, #M063429-2), anti-ACTA2 (Sigma-Aldrich #C6198) ...
-
bioRxiv - Genetics 2019Quote: ... coli bacteria (Sure 2, Agilent Technologies) were transformed with pFPV25.1 (Valdivia and Falkow 1996 ...
-
bioRxiv - Physiology 2023Quote: ... and 50mM of 2-DG (Agilent) were injected during the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... clone D33 (Agilent Technologies M076029-2); western blot ...
-
bioRxiv - Systems Biology 2023Quote: ... Epoch 2 (BioTek, now: Agilent Technologies) or Infinite 200 Pro (TECAN trading AG ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...