Labshake search
Citations for Agilent :
101 - 150 of 1949 citations for Caspase 9 CASP9 Antibody Pair since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... yielding library sizes with an average distribution of 500-750 base pairs in length as determined using the Agilent hsD1000 Screen Tape System (Agilent Genomics). Arrays were sequenced within multi-sample pools on an Illumina Nova-Seq through the Broad Institute walk-up sequencing core ...
-
bioRxiv - Biophysics 2020Quote: ... The desired base pairs coding for Cys were introduced using overlapping primers with the QuikChange II site-directed mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Neuroscience 2019Quote: All 60 ex-vivo left brain hemispheres were scanned in pairs overnight with a 4.7T MRI scanner (Agilent Technology Inc., USA) at Radiobiology Research Institute ...
-
bioRxiv - Neuroscience 2021Quote: ... The quality of the libraries is determined using the Standard High sensitivity NGS Fragment analysis kit (DNF-474, 1-6000 base pair) on the Agilent Fragment analyzer (Agilent, USA), yielding approximately 260 bp size fragments ...
-
bioRxiv - Microbiology 2023Quote: ... Microtiter plates containing technical replicates for each antibiotic-berberine pair were incubated for 18 hours with vigorous shaking using in Cytation5 Imaging Reader (Agilent BioTek). OD600 values were recorded every 15 minutes and select time points (0 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lung samples underwent antigen retrieval (pH 9 buffer) using a Dako PT Link pre-treatment module (Agilent). Samples were washed and blocked for 10 min (Dako protein block ...
-
bioRxiv - Molecular Biology 2022Quote: contains the canonical human HELZ2 long isoform cDNA (2649 bps) cloned into pCMV-3Tag-9 (Agilent Technologies), which allows the expression of a HELZ2-3xMYC fusion protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... and subjected to heat-induced antigen retrieval for 30 min using pH 9 target retrieval solution (Dako). Endogenous peroxidases were blocked with 3% hydrogen peroxide in methanol for 10 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... RIN (RNA integrity number) numbers were always in the range of 9 to 10 (Agilent 2100 Bioanalyzer). 250ng of total RNA samples were used ...
-
bioRxiv - Immunology 2023Quote: After deparaffinization and antigen retrieval using Dako Target Retrieval Solution at pH 9 (S236784-2, Agilent technologies) in a water bath (96°C for 30 min) ...
-
bioRxiv - Immunology 2024Quote: ... tissues underwent antigen retrieval by submerging the slides in 1X Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... tissues underwent antigen retrieval by submerging the slides in 1X Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Immunology 2020Quote: ... Mutations of W169G on ASCCARD (Type IIa) and G20K on caspase-1CARD (Type IIb) were performed by QuikChange Mutagenesis (Agilent Technologies). All plasmids were confirmed by Sanger sequencing ...
-
bioRxiv - Physiology 2022Quote: ... Concentrations of enriched dsDNA fragments with specific adapters were determined and base pair average size and library integrity were analyzed using the Bioanalyzer DNA High Sensitivity chips (Agilent, Cat. 5067-4626). Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... Concentrations of enriched dsDNA fragments with specific adapters were determined and base pair average size as well as library integrity were analyzed using the Bioanalyzer DNA High Sensitivity chips (Agilent, Cat. 5067-4626). Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:300) was used with the Dako High pH Target Retrieval Solution (Tris/EDTA, pH 9; Agilent, USA) (20 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Biochemistry 2019Quote: ... The time-resolved fluorescence emission of the FRET Cy3/Cy5 donor/acceptor pair was measured in a Cary Eclipse fluorescence spectrometer (Agilent, Santa Clara, CA, USA) with 10 nm excitation and emission slit widths ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... Heat-based antigen retrieval was performed using 1× antigen retrieval solution at pH 9 (Agilent Technologies; Santa Clara, CA) for 1 hour (30 min at 95C ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The products were analysed by HPLC on a Shimadzu HPLC system (http://www.shimadzu.com) using a 5-lM C18 column (150 9 4.6 mm; Zorbax; Agilent, http://www.agilent.com). A linear gradient with increasing acetonitrile (solvent A ...
-
bioRxiv - Immunology 2023Quote: ... a minimum of 500 ng of high-quality RNA with RNA integrity number (RIN) > 9 (determined using Agilent Bioanalyzer) was used for the library preparation ...
-
bioRxiv - Systems Biology 2023Quote: ... The sections were then immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent, Santa Clara, CA) and incubated at 97°C for 40 min and cooled down to 65°C using Lab vision PT module (Thermofisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... The sections were then immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent, Santa Clara, CA) and incubated at 97°C for 40 min and cooled down to 65°C using Lab vision PT module (Thermofisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... The sections were then immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent, Santa Clara, CA) and incubated at 97°C for 40 min and cooled down to 65°C using Lab vision PT module (Thermofisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... The sections were then immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent, Santa Clara, CA) and incubated at 97°C for 40 min and cooled down to 65°C using Lab vision PT module (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Selected de-waxed brain paraffin sections containing dorsal hippocampus were treated with DakoTarget retrieval solution (pH 9) (Dako, Denmark) at 95° in a Dako PT Link to retrieve protein antigenicity ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... All samples had an RNA Integrity (RIN) score of >9 as determined by the Agilent 2100 bioanalyzer or Agilent 2200 Tapestation system (Agilent). For RNAseq of cell lines (Figure 5C) ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Molecular Biology 2022Quote: ... and DDX60L cDNAs were amplified from either a HeLa-JVM or HEK293T total cDNA library and inserted into the NotI and XhoI restriction sites in the pCMV-3Tag-9 vector (Agilent Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Neuroscience 2021Quote: ... 3 μm paraffin-embedded tissue sections were either dewaxed and subjected to antigen retrieval treatment with Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent) or dewaxed as part of the antigen retrieval process using the Low pH EnVision ™ FLEX Target Retrieval Solutions (K8005 ...
-
bioRxiv - Cancer Biology 2019Quote: ... MSH2 and PMS2 and at pH 9 for MSH6) using a detection system suitable for the Dako Autostainer Link 48 (EnVision FLEX, Dako).
-
bioRxiv - Cell Biology 2020Quote: ... Prior to immunohistochemistry antigen retrieval was performed using Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent). Quenching of endogenous peroxidase was performed by a 10 min incubation with Peroxidase-Blocking Solution (Dako REAL S2023) ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Immunology 2021Quote: ... Epitope retrieval was performed at 97C for 10 min with the Dako Target Retrieval Solution pH 9 (Agilent, S236784-2) on a Lab Vision PT Module (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Heat-mediated epitope retrieval was performed by incubating slides in a beaker containing Tris EDTA solution (pH 9; Dako, #S2367) in a pressure cooker for 20 minutes ...