Labshake search
Citations for Agilent :
251 - 300 of 1829 citations for Caspase 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and normal rabbit Ig (Dako X0936) diluted with 1% G-Block (Genostaff)/TBS (Tris buffered Saline ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-ubiquitin (1:2000; rabbit; Dako), anti-GFP (ab290 ...
-
bioRxiv - Neuroscience 2022Quote: ... GFAP (rabbit, 1:1000, Dako, Z0334); Red Fluorescent Protein (RFP ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit GFAP 1:1000 (Agilent Z0334). Slides were washed 3x PBST then incubated with secondary antibody 1:500 in in 5% normal goat or normal donkey serum in PBST for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-GFAP (1:1500, Dako), rabbit anti-Ki67 (1:150 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:1000, Dako), and anti-human Tau (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:600; Dako); and rabbit anti-tdTom (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or rabbit anti-mouse (Dako, PO260) secondary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (Dako;1:1000), rabbit anti-ALDH1L1 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (Agilent Cat. #Z0334) at 1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti- Beta2microglobulin (Dako 1:500); mouse anti-ACE2 (Proteintech ...
-
bioRxiv - Immunology 2023Quote: ... anti-rabbit HRP (1:10000) (DAKO). Mouse anti ZFP36 (Origene #OTI3D10 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti- GFAP (Rabbit pAb, Dako). Confocal images were acquired with a laser scanning confocal microscope (Zeiss LSM 700) ...
-
bioRxiv - Molecular Biology 2023Quote: ... HRP-anti-rabbit IgG (Dako, P0448).
-
bioRxiv - Biochemistry 2023Quote: ... rabbit polyclonal antimouse-HRP conjugate (Dako). This was then washed as described above ...
-
bioRxiv - Immunology 2024Quote: ... Rabbit anti-mouse HRP (Dako, P0260) was used as a secondary antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... Rabbit Linker (Agilent Cat#GV80911-2). Epitope Retrieval Solution 1 (Leica Cat#AR9961) ...
-
bioRxiv - Neuroscience 2024Quote: ... antiGFAP (rabbit, 1:500, Dako, USA), antiOCT4 (rabbit ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit anti-goat IgG (P0449) (Agilent) or goat anti-rat IgG (sc-2006 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Rabbit/Mouse (cat. no. K5007, Agilent) was used as secondary detection reagent ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... or polyclonal rabbit anti-GFAP (Dako); polyclonal chicken anti-GFP and rabbit anti-53BP1 (Novus Biologicals) ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100 (DAKO; 1:600), mouse anti-Myelin Basic Protein (Covance SMI 94 ...
-
bioRxiv - Microbiology 2024Quote: ... sheep (rabbit anti-sheep IgG, Dako), and human (goat anti-human IgG ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Genomics 2019Quote: ... The secondary antibodies rabbit anti-mouse (#P0260) and goat anti-rabbit (#P0448) HRP were purchased from Dako Denmark ...
-
bioRxiv - Physiology 2021Quote: Two truncated recombinant fibrinogen α-chain variants (α220 and α390) were produced using QuikChange II Site-Directed Mutagenesis Kits from Agilent Technologies (Stockport ...
-
bioRxiv - Immunology 2020Quote: ... The recombinant Ad5 genomes with HA inserts were linearized with PacI and buffer exchanged using a Strataprep PCR purification kit (Agilent Technologies). The linearized recombinant gDNA was transfected into 293 cells using the PolyFect Transfection Reagent (Qiagen) ...
-
bioRxiv - Biophysics 2019Quote: Human myosin IIa S1 and lever-arm-less S1: Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies). The produced adenoviruses were purified using AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-Iba1 (1:1000; Wako Chemical, Richmond, VA) and rabbit anti-S100 (1:5000; Dako, Glostrup, Denmark). The following secondary antibodies were used ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... A secondary antibody (swine anti-rabbit, Dako) was applied for 30 min at 1:300 ...
-
bioRxiv - Cell Biology 2020Quote: ... Goat Anti-Mouse/Rabbit Immunoglobulins/HRP (Dako) secondary antibodies were used to detect primary antibodies ...
-
bioRxiv - Developmental Biology 2021Quote: ... TTR (rabbit 1:100, DAKO catalogue # A0002), AQP1 (mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-GFAP (Dako, Z0334, 1:250), rabbit anti-OLIG2 (IBL ...
-
bioRxiv - Molecular Biology 2021Quote: ... and anti-rabbit IgG (Dako, 1/2000) were used as secondary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... α-rabbit horseradish peroxidase conjugate (1:2000, Dako). When multiple antibodies of the same origin were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... or goat anti-rabbit IgG (P0448, Dako) secondary antibody at room temperature using ECL Western Blotting substrate (Pierce) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and Rabbit anti-Mouse HRP(Dako #P0161).
-
bioRxiv - Cancer Biology 2021Quote: ... and Goat anti-Rabbit HRP (Dako, #P0448), were used at 1:5000 and incubated with membranes for 1 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... von Willebrand factor (1:200, rabbit, Dako) and UEA-1 (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-GFAP (1:250; Dako, Z0334), rabbit anti-Huntingtin clone EM48 (1:100 ...