Labshake search
Citations for Agilent :
1 - 50 of 107 citations for Beta glucuronidase GUSB E.coli His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Nhp6 was expressed as a N-terminal 6x His-tag fusion protein in E.coli BL21-CodonPlus (DE3)-RIL cells (Agilent). A colony of cells freshly transformed with plasmid p1035 was grown in 3 L of LB supplemented with 50 μg/mL ampicillin and 34 μg/mL chloramphenicol at 37°C ...
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Biochemistry 2021Quote: E.coli BL21-Gold(DE3) (Agilent Technology) transformed with the plasmids encoding the His-GST-tagged proteins (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: E.coli ArcticExpress DE3 cells (Agilent, #230192) were grown overnight in 5 ml LB supplemented with the respective antibiotic for the expression vector ...
-
bioRxiv - Biochemistry 2021Quote: ... transformed E.coli BL21 (DE3) pLysS (Agilent) cells were cultured in deuterated (2H ...
-
bioRxiv - Molecular Biology 2023Quote: ... or E.coli XL10-Gold (Agilent Technologies) was used as the cloning host for constructing CRISPR plasmids ...
-
bioRxiv - Biochemistry 2022Quote: E.coli BL21(DE3) gold bacteria (Agilent Technology) containing plasmids encoding the 6-His-GST fusion proteins were grown in 4 L 2xYT (16 mg/mL peptone ...
-
bioRxiv - Microbiology 2023Quote: ... E.coli Arctic Express (DE3) RP (Agilent Technologies) was transformed with pMS007 and pMS008 ...
-
bioRxiv - Biochemistry 2020Quote: ... E.coli XL1-Blue strain (Agilent Technologies, Cat#200249) was used for single-stranded (ss ...
-
bioRxiv - Immunology 2020Quote: ... was transformed into BL21 (DE3)-RIPL E.coli (Agilent). Single colonies were picked and inoculated into an LB overnight starter culture ...
-
bioRxiv - Biochemistry 2023Quote: ... E.coli XL-10 cells were provided by STRATAGENE EUROPE.
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were maintained in E.coli XL-1 Blue (Stratagene). Bacmids were maintained in DH10Bac (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and propagated in E.coli XL 10 Gold cells (Agilent). All cassettes contain Kozak sequences ...
-
bioRxiv - Systems Biology 2021Quote: ... then inserted to electrocompetent E.coli cells (ElectroTen-Blue, Agilent Technologies) using electroporation ...
-
bioRxiv - Biophysics 2022Quote: ... Construct was electroporated into E.coli (BL21-Gold Competend Cells) (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and transformed to E.coli strain BL21-CodonPlus(DE3)-RIPL (Agilent). The expressed recombinant protein was solubilized in a denaturing buffer (6 M HCl-Guanidine ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid was transformed into E.coli BL21(DE3) cells (StrataGene) and protein expression induced with 0.5 mM IPTG at 37°C for 4 h ...
-
bioRxiv - Immunology 2022Quote: ... 50µM beta-mercaptoethanol (Agilent Technologies), 1% penicillin-streptomycin (Corning Inc) ...
-
bioRxiv - Biochemistry 2020Quote: ... Fusion protein was expressed in E.coli BL21(DE3) CodonPlus-RIL (Stratagene) in Super Broth Auto Induction Media (Formedium ...
-
bioRxiv - Biophysics 2022Quote: ... Cloned TnsBCTD was transformed to E.Coli BL21-RIPL competent cells (Agilent) and purified following the protocol for TniQ purification ...
-
bioRxiv - Genetics 2022Quote: ... All plasmid constructs were isolated from the E.coli SURE strain (Stratagene) and (GAA)100 repeats were confirmed by Sanger sequencing.
-
bioRxiv - Microbiology 2019Quote: ... The resulting plasmid was transformed into XL10 gold competent E.coli cells (Agilent). Plasmids for transfection were prepared by Midi-preps (QIAGEN ...
-
bioRxiv - Plant Biology 2019Quote: ... which was transformed into E.coli strain BL21 RIL (Agilent Technologies; Waldbronn, Germany) to be expressed as C-terminally 6xHis-tagged recombinant protein ...
-
bioRxiv - Neuroscience 2020Quote: ... and Beta-Amyloid (Dako, M0872, 1:100) were diluted in Bright Diluent (ImmunoLogic ...
-
bioRxiv - Neuroscience 2019Quote: ... Immunohistochemistry for amyloid beta (BA4, M087201-2, Dako) and pTau (AT8 ...
-
bioRxiv - Microbiology 2020Quote: ... coli NEB 10-beta and BL21 (DE3) (Stratagene), respectively.
-
bioRxiv - Biochemistry 2019Quote: XL-1 and BL21(DE3)pLysS strains of E.coli were purchased from Stratagene (USA) and a previously described vector pGEMEX-1(his6 ...
-
bioRxiv - Cell Biology 2022Quote: ... GST-TNY constructs were transformed into E.coli BL21 codon plus-RIL strain (Agilent Technologies). Cells were grown in LB media and induced for 5 hrs at 30°C with 0.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2022Quote: ... The construct was transformed into E.coli strain BL21 codon plus-RIL (DE3) (Agilent technologies). Induction of recombinant TNY1 expression in E ...
-
bioRxiv - Biochemistry 2023Quote: hSirt3102-399 was expressed in E.coli Arctic Express (DE3) cells (Agilent Technologies, Wilmington, DE), as previously described (30) ...
-
bioRxiv - Cell Biology 2022Quote: ... The expression of the GST-GAP fusion protein in E.coli strain BL-21-RILP (Stratagene) and its purification using Glutathione Sepharose 4B were performed as described previously (Jung et al. ...
-
bioRxiv - Biophysics 2020Quote: The hSirt3102-399 was expressed in E.coli Arctic Express (DE3) cells (Agilent Technologies, Wilmington, DE) as per manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins were expressed using E.coli BL21 (DE3) RIL according to the manufacturer’s protocol (Stratagene). The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: ... The hSirt3,102-399 was expressed in E.coli Arctic Express (DE3) cells (Agilent Technologies, Wilmington, DE) as per manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2019Quote: ... Histone expression plasmids were from Narlikar lab and BL21(DE3)pLysS competent E.coli cells were from Agilent Technology (USA) ...
-
bioRxiv - Molecular Biology 2021Quote: Protein expression was conducted in E.coli BL21 (DE3) Codon Plus cells (Agilent Technologies, San Diego, CA, USA). Induced cultures were grown at 18° C overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... and HER2-Nb-pH-Lemon were transformed into chemically competent E.coli Arctic Express (DE3) (Agilent Technologies, Waldbronn, Germany)) following the manufactureŕs guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragments encoding the ACR-16 TM3-4 loop or the SDN-1 intracellular domain full length or lacking the EYFA PDZ binding motif were cloned to pGEX-3X expression vector and then transfected into Arctic express E.coli strain (Agilent). Bacterial clones were first cultured overnight in 5 mL LB medium supplemented with 100 mg/mL ampicillin ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting constructs were sequenced to ensure that no other changes had occurred prior transformation into XL10-Gold E.coli (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Genetics 2023Quote: His6-SUMO-RhinoCD constructs (spanning Rhino residues 20-90 in the vector pET-28) were transformed into the E.coli strain BL21-CodonPlus (DE3)-RIPL (Agilent) for large-scale expression using standard methods ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 μL of AccuScript Hi-Fi (Agilent Technologies) was added up to a 10 μL volume ...
-
bioRxiv - Microbiology 2022Quote: ... A 300×7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Genomics 2023Quote: ... were used to assess the Hi-C libraries (Agilent). The libraries were sequenced at New York Genome Center (NYGC ...
-
bioRxiv - Systems Biology 2023Quote: ... A 300 × 7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Bioengineering 2021Quote: ... For bacterial expression of mEGFP::HCF in E.coli BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent Technologies, Santa Clara, CA, USA), the cDNA of the fusion protein was cloned in pET21a (Merck KGaA ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into pVp16-Dest vector for IPTG (isopropyl-β-thiogalactopyranoside)-induced expression (3 h at 37°C) in E.coli strain ArcticExpress (Agilent). After sonication ...
-
bioRxiv - Microbiology 2023Quote: The murine and human proteins (variants R166H and R168H, respectively) were produced in E.coli BL21 CodonPlus(DE3) RIL (Agilent Technologies) carrying the plasmid pHisTrx-mα-DGN and pHisTrx-hα-DGN ...
-
bioRxiv - Biochemistry 2020Quote: ... A plasmid containing eight copies of this 145 bp telomeric DNA was cloned into Sure2 E.coli (Agilent Technologies Singapore Pte. Ltd) following established protocols (32) ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections were processed for amyloid beta (clone 6F/3D, Agilent cat no. M0872) DAB histology by the Massachusetts ADRC ...