Labshake search
Citations for Agilent :
1 - 50 of 145 citations for B2M Cynomolgus HEK293 Flag His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... anti-B2M (Dako); anti-TAP1 (EMD Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit B2m 1:10 (Agilent A0072) primary was added to surface stain ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following antibodies were used for the Immunohistochemistry of the clinical : B2M (B2M Polyclonal, DAKO, A0072; RRID: AB_812325) and HLA (HLA-1/MHC-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies were all used at 1:10,000 concentration: rabbit B2m (Dako A0072), goat TdTomato (MyBiosource MBS448092) ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After 3 days ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After three days ...
-
bioRxiv - Neuroscience 2020Quote: ... human embryonic kidney cells 293 (HEK293; Agilent #240073) were calcium phosphate-transfected with the recombinant AAV2 plasmid and a 3-helper system ...
-
bioRxiv - Neuroscience 2019Quote: ... and RepCap5 (Applied Viromics) were transfected to HEK293 cells (AAV293, Stratagene). After 3 days of incubation ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Respirometry on HEK293 cells were performed on a SeaHorse XF Pro (Agilent) using the real-time ATP rate assay kit (103591-100 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 μL of AccuScript Hi-Fi (Agilent Technologies) was added up to a 10 μL volume ...
-
bioRxiv - Microbiology 2022Quote: ... A 300×7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Genomics 2023Quote: ... were used to assess the Hi-C libraries (Agilent). The libraries were sequenced at New York Genome Center (NYGC ...
-
bioRxiv - Systems Biology 2023Quote: ... A 300 × 7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-FLAG (#200474) was from Agilent. Anti-MAPK4 antibody was purchased from ABGENT (#7298b).
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vector was produced using HEK293 T-cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15 cm dishes (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vectors were produced using HEK293 T cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15-cm dishes (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV plasmids were co-transfected with a pDP6 helper plasmid into HEK293-AAV cells (Agilent). Cells were lysed 72 h after transfection and viral particles were purified using Iodixanol gradient followed by separation ion-exchange chromatography (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-FLAG (Agilent, 1:800 dilution), rabbit anti-V5 (GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Microbiology 2024Quote: ... and a 300×7.8 mm Hi-Plex Exchange column (Agilent, USA) was used to quantify glucose ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... and pCMVTag 4 expression control plasmid containing the firefly luciferase gene fused with the FLAG tag (luc-FLAG) were obtained from Stratagene. The plasmid 15cxCAT contained the interleukin-2 (IL-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... bound to monoclonal anti-Flag antibody (Agilent Technologies) for 5 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: The MAPK/ERK pathway was assayed in HEK293 cells with the Elk1 trans-reporting system (PathDetect, Agilent). HEK293 cells were maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2 viruses were produced by large-scale triple CaPO4 transfection of HEK293-AAV cells (#240073, Stratagene) as described previously (Van Loo et al. ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... AAV9-CAG-tdTomato and AAV-KP1-CAG-tdTomato were produced in HEK293 cells (RRID: CVCL-6871, Agilent) by an adenovirus-free plasmid transfection method and purified by two rounds of cesium chloride density-gradient ultracentrifugation followed by dialysis as described previously.53 AAV9 and AAV-KP1 helper plasmids were provided by J ...
-
bioRxiv - Molecular Biology 2020Quote: The plasmid pUHD-FLAG-H3.3K56R and pUHD-FLAG-H3.3K56Q were constructed using a Quick Change II Site-Directed Mutagenesis Kit (Agilent, CA, United States), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A rat anti-FLAG mAb was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Pathology 2020Quote: ... The self-complementary scAAV9-CB-SMN vector was produced by calcium phosphate transfection of HEK293-AAV cells (Agilent) with pAAV-CB-SMN[57] and pDF9 plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed using Accuscript Hi Fidelity First Strand Synthesis kit (Agilent). The amount of RNA entered into the reaction was normalised between samples ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Molecular Biology 2019Quote: pTrex-6×His-TOP1Y723F was generated by QuikChange II XL SDM kit (Agilent) using oligonucleotides 5’-CTAGGGTCCAGAAAATTGAGTTTGGAGGTTCCCAGG-3’ pTrex-6×His-TOP1 K117 ...
-
bioRxiv - Neuroscience 2021Quote: ... shuttle plasmids were co-transfected with the pDF9 helper plasmid into HEK293-AAV cells (Agilent Technologies, Santa Clara, USA). Cells were lysed 72h following transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Flag-ErbB3 cDNA was subjected to site-directed mutagenesis (Agilent) to generate LL866/7AA mutant Flag-ErbB3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rat monoclonal to flag tag (Agilent Cat# 200474, RRID:AB_10597743). The monoclonal to Xenopus laevis Sox3 (DSHB Cat# DA5H6 ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned and inserted into pCMV5-FLAG vector (Agilent Technology). The mouse SVZ cDNA was prepared as described in the ‘qPCR analysis of migrating neurons’ section ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-Trabid mutants generated by site-directed mutagenesis (QuikChange, Agilent), pEGFP-C1-APC (Rosin-Arbesfeld et al ...
-
bioRxiv - Genomics 2019Quote: ... The concentration of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies), and the Hi-C libraries were paired-end sequenced (HiSeq 2500 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the reaction was stopped by adding 2X GE HI-RPM hybridization buffer (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Mutations were introduced into Flag-CinBwNo in p416GAL1 by Quikchange (Agilent; mutagenesis using primers listed in Supplementary Table 2).
-
bioRxiv - Cancer Biology 2021Quote: ... Quantity and integrity of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies).
-
bioRxiv - Microbiology 2022Quote: ... the stationary phase was a Hi-Plex H column (300 x 7.7 mm; Agilent, USA) and the mobile phase was 0.005 M H2SO4 solution at a flow rate of 0.4 ml/min ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Immunology 2019Quote: ... FLAG-RNF144A C198A was generated by site-directed mutagenesis using Quickchange (Stratagene) with primers X and X ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Microbiology 2023Quote: ... α-FLAG MAb (rat) (M2) was purchased from Agilent (Santa Clara, CA). α-HA MAb (mouse) ...