Labshake search
Citations for Agilent :
1 - 50 of 1381 citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Pathology 2024Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2024Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... p53 (clone DO-7, Dako; RRID:AB_2889978); p53 ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Immunology 2024Quote: ... Plates were briefly centrifuged and then imaged at 6-hour intervals for mCherryNLS fluorescence using the BioTek Cytation 7 Cell Imaging Multimode Reader (Agilent) integrated with the BioTek BioSpa 8 Automated Incubator (Agilent) ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Neuroscience 2024Quote: ... well above the 7 cutoff (Agilent Technologies, Santa Clara, CA). RNA concentration was determined with Quant-it RNA High Sensitivity assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired on a 7 Tesla MRI scanner (Agilent Inc.) (23 ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
bioRxiv - Immunology 2024Quote: ... Samples with an RNA integrity number (RIN) below 7 (BioAnalyzer, Agilent) did not proceed to sequencing.
-
bioRxiv - Biochemistry 2024Quote: ... Only high-quality RNA (RNA integrity number > 7, Agilent 2100 Bioanalyzer) was used for microarray analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Biochemistry 2024Quote: ... 13C NMR spectrum was recorded on a Varian 500 MHz spectrometer equipped with a 5 mm 1H{13C} XSens cold probe (Varian Inc., Palo Alto, CA, USA, now Agilent Technologies). NMR spectra were referenced to the solvent signals (CHD2OD ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Neuroscience 2020Quote: ... blocked using 10% Normal Goat Serum (NGS) and incubated overnight with the following primary antibodies in 5% NGS overnight at 4°C: rabbit anti-GFAP (DAKO; #Z0334;1:1000), rat anti-L1-CAM (Millipore ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked for with 5% BSA for 1h prior to immunofluorescence staining performed as in (Clément et al., 2018) with PCNA antibody (DAKO, M879, 1:1000). We detected EdU using the Click-iT EdU Cell Proliferation kit as described in (Gatto et al. ...
-
bioRxiv - Immunology 2021Quote: A multi-channel 7 Tesla MRI scanner (Agilent Inc., Palo Alto, CA) was used to image brains in skulls ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation astrocytes were switched to XF media (Agilent) and then assessed using the previously described Mitochondrial Stress Test Protocol [24] ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Genomics 2020Quote: ... and electroporated in 5 separate cuvettes containing 4 µL of the plasmid and 40 µL of ElectroTen-Blue electrocompetent cells (Agilent Santa Clara, CA). After a 1 hour outgrowth in LB at 37C ...
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...