Labshake search
Citations for Agilent :
301 - 350 of 3032 citations for 8H Purin 8 one 1 7 dihydro 6 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Immunology 2019Quote: ... or low pH antigen retrieval buffer (Dako Target retrieval Solution, pH 6, Dako, Denmark) (for PCNA) ...
-
bioRxiv - Immunology 2021Quote: ... mouse thymocytes were exposed to 254 nm UV-irradiation for 6 minutes (Stratagene Stratalinker) followed by labelling with 2 μM CFSE (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... the heat-induced antigen retrieval was performed in Target Retrieval solution (pH 6) (Dako) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: Heat-induced antigen retrieval was performed in either Target Retrieval solution (pH 6) (Dako) or in EDTA (pH 8.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was carried out using citrate buffer solution pH 6 (Dako, Glostrup, Denmark). Detection was performed using the EnVision method (Dako ...
-
bioRxiv - Microbiology 2019Quote: All experiments were performed with a one-step enzymatic kit in a Stratagene Mx3005P qPCR system (Agilent Technologies). For this experiment Brilliant III ultra-fast qRT-PCR master mix (Agilent ...
-
bioRxiv - Microbiology 2019Quote: ... and Cy3-labeled cRNAs were synthesized using the Low Input Quick Amp Labeling kit (one-color, Agilent Technologies). Labeled probes were purified with RNeasy kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... One hour before the start of the experiment we replaced culture medium with XF Assay Medium (Agilent Technologies) pH7.4 ...
-
Metabolic switching and cell wall remodelling of Mycobacterium tuberculosis during bone tuberculosisbioRxiv - Microbiology 2022Quote: ... tuberculosis RNA was accomplished using One-Color Microarray-Based Low Input Quick Amp WT Labelling kit (Agilent Technologies) as per the manufacturer’s protocol using 300ng of input RNA ...
-
bioRxiv - Immunology 2020Quote: cDNA was synthesized by using the AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, US) using extracted RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Nanodrop One and RNA integrity was quantified with the Agilent 4200 Tapestation (Agilent Technologies, Santa Clara, CA). Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx ...
-
bioRxiv - Molecular Biology 2020Quote: Cybrid cells were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent, 103010-100). The day of the assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome, Agilent Technologies, design ID 074809) and subsequent washing and drying of the slides were performed following the Agilent hybridization protocol in Agilent hybridization chambers ...
-
bioRxiv - Physiology 2021Quote: ... Génopole Toulouse Midi-Pyrénées) using Sureprint G3 Mouse GE v2 microarrays (8×60K, design 074809, Agilent Technologies), according to the manufacturer's instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200 μl of distilled water was added to the sensor-containing Seahorse 8-well fluxpaks (Agilent Technology), which were coated with Poly-D-Lysine ...
-
bioRxiv - Biochemistry 2019Quote: ... all samples were processed and hybridized to SurePrint G3 Mouse Gene Expression 8 × 60 K (Agilent Technologies). Fluorescence was detected using Agilent DNA Microarray Scanner ...
-
bioRxiv - Neuroscience 2023Quote: Neurospheres were removed from 96-well plates and pipetted into 8-well Seahorse XF HS miniplates (Agilent) coated with 15 µg/mL poly-L-ornithine and 10µg/mL laminin ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Immunology 2024Quote: Initial experiments were conducted with an 8-well Seahorse XFp extracellular flux analyser (Seahorse Bioscience, Inc, USA) to determine cell seeding density and FCCP concentration (Supplementary Data) ...
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA from each extraction was quantified using a NanoDropTM One spectrophotometer and integrity analysed using a Bioanalyzer (Agilent) with the RNA 6000 Nano kit ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random nonamer primers ...
-
bioRxiv - Genetics 2022Quote: ... in one individual by the Hospital for Sick Children (Toronto, Canada) using the Agilent SureSelect Focused Exome Kit (Agilent); in one individual at Hôpital de la Pitié Salpêtrière (Paris ...
-
bioRxiv - Molecular Biology 2023Quote: ... One µL of the library was analyzed on an Agilent 2100 Bioanalyzer using a High Sensitivity DNA chip (Agilent) to assess product profiles and concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Genetics 2019Quote: ... slides were incubated in antigen retrieval solution (Target Retrieval Solution Citrate pH 6; Dako cytomation) at 98°C for 20 minutes and then cooled at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... or hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.75 μg labeled cRNA was fragmented and hybridized to custom whole-genome human 8 × 60K microarrays (Agilent-048908) according to the supplier’s protocol (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a genome-wide gene expression profiling was set up using the 8×60K ArrayXS Zebrafish platform by Agilent and performed by OakLabs GmbH (Henningsdorf ...
-
bioRxiv - Neuroscience 2020Quote: ... Cy3-labeled RNAs were hybridized to SurePrint G3 Mouse Gene Expression v2 8×60K Microarray Kit (Agilent Technologies) at 65 °C for 17h ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with water and then blocked in a serum-free protein block buffer for 8 min (Dako, X0909). Primary CD133 antibody (Miltenyi Biotec ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: The complete RNA library was hybridised to SurePrint G3 Mouse GE 8×60K Microarrays (Agilent, Cat No. G4852A) using a partially modified version of manufacturer’s protocol as described in Version 6.9.1 of ‘One-Color Microarray-Based Gene Expression Analysis Protocol’ ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide microarrays for human whole genome (G4858A design 072363, 8×60k chips SurePrint G3 unrestricted GE, Agilent Technologies) were used for global gene expression analysis ...
-
bioRxiv - Genomics 2021Quote: Submicroscopic CNVs were identified in patients referred for genetic diagnosis through the 8×60k ISCA platform (Agilent Technologies), with a mean actual resolution of about 120 kb ...
-
bioRxiv - Genetics 2019Quote: DNA from patient LA was tested using an 8 x 60K SurePrint G3 custom CGH + SNP microarray (Agilent) and analysed using Agilent Cytogenomics software 4.0 ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... OCR and ECAR were measured using an 8-well Seahorse XFp Analyzer according to manufacturer’s instructions (Agilent Technologies). In brief ...