Labshake search
Citations for Agilent :
101 - 150 of 883 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 µm (Agilent Technologies, Santa Clara, CA). The following HPLC conditions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) was used for peptide separation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) constituted the stationary phase ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL of 10X Pfu buffer (Agilent) 1.25 μL of 10 mM dNTP (Thermofisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl Fe(III)-NTA cartridges (Agilent) were primed with 100 μL of 0.1% TFA in H2O and equilibrated with 50 μl 0.1% TFA in 80% ACN [37] ...
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... C18 cartridges (Agilent, 5 µL bed volume) were primed with 100 µL 90% acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were resuspended in 5% formic acid/5% acetonitrile and fractionated over a ZORBAX extended C18 column (Agilent, 5μm particles ...
-
bioRxiv - Microbiology 2019Quote: ... 1% acetonitrile/0.5% formic acid was used as eluent for 5 minutes to trap and desalt the peptides on the enrichment column (Zorbax SB C18, 0.3 × 5 mm, Agilent). An acetonitrile/0.1% formic acid gradient from 5% to 40% acetonitrile was then used within 120 minutes to separate the peptides on a Zorbax 300 SB C18 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.75 μg labeled cRNA was fragmented and hybridized to custom whole-genome human 8 × 60K microarrays (Agilent-048908) according to the supplier’s protocol (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a genome-wide gene expression profiling was set up using the 8×60K ArrayXS Zebrafish platform by Agilent and performed by OakLabs GmbH (Henningsdorf ...
-
bioRxiv - Neuroscience 2020Quote: ... Cy3-labeled RNAs were hybridized to SurePrint G3 Mouse Gene Expression v2 8×60K Microarray Kit (Agilent Technologies) at 65 °C for 17h ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with water and then blocked in a serum-free protein block buffer for 8 min (Dako, X0909). Primary CD133 antibody (Miltenyi Biotec ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: The complete RNA library was hybridised to SurePrint G3 Mouse GE 8×60K Microarrays (Agilent, Cat No. G4852A) using a partially modified version of manufacturer’s protocol as described in Version 6.9.1 of ‘One-Color Microarray-Based Gene Expression Analysis Protocol’ ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide microarrays for human whole genome (G4858A design 072363, 8×60k chips SurePrint G3 unrestricted GE, Agilent Technologies) were used for global gene expression analysis ...
-
bioRxiv - Genomics 2021Quote: Submicroscopic CNVs were identified in patients referred for genetic diagnosis through the 8×60k ISCA platform (Agilent Technologies), with a mean actual resolution of about 120 kb ...
-
bioRxiv - Genetics 2019Quote: DNA from patient LA was tested using an 8 x 60K SurePrint G3 custom CGH + SNP microarray (Agilent) and analysed using Agilent Cytogenomics software 4.0 ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quick Amp Labeling Kit and SurePrint G3 Human Gene Expression 8×60Kv3 Microarray (Cat. No. G4851C, Agilent Technologies) was used corresponding to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA integrity was assessed using an Agilent 2100 Bioanalyzer (cutoff value of RIN 8 or higher; Agilent Technologies). cDNA libraries were clustered onto a TruSeq paired-end flow cell ...
-
bioRxiv - Microbiology 2023Quote: ... 1.8 μm) and a guard column Zorbax Eclipse Plus C18 (2.1 × 5mm, 1.8 μm) both provided by Agilent technologies (Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... OCR and ECAR were measured using an 8-well Seahorse XFp Analyzer according to manufacturer’s instructions (Agilent Technologies). In brief ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant adeno-associated viruses (AAVs) with serotype 8 were produced using the AAV helper-free system (Agilent Technologies). Human embryonic kidney (HEK ...
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring OD600 every 2.5 min for 8 hours using a BioTek 800 TS (Agilent) with continuous ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Cy3-labeled aRNA was hybridized overnight to 8 x 60K 60-mer oligonucleotide spotted microarray slides (Agilent Technologies ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Cell Biology 2020Quote: Gene expression analysis were performed with Agilent® SurePrint G3 Human GE 8×60K Microarray (Agilent Technologies, AMADID 39494) with the following dual-color design ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA Integrity was ensured by obtaining an RNA Integrity Number - RIN >8 with Agilent 2100 Bioanalyzer (Agilent Technologies, Germany).
-
bioRxiv - Immunology 2022Quote: ... and the resulting peptides were captured and desalted by C-8 trap column (2.1 × 20 mm, Zorbax Eclipse XDB-C8 trap (Agilent) followed by loading on to C-18 column (2.1 × 50 mm in size ...
-
bioRxiv - Physiology 2020Quote: ... 20 μL samples were injected into Hi-Plex H column (300×7.7 mm; 8 μm particle size, Agilent Tech.). 0.1% formic acid in Milli-Q water (Merck Millipore ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: Day 30-50 iPSC-derived mDANs were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent) previously coated with Poly-L-ornithine and laminin ...
-
Hypusinated eIF5A is expressed in pancreas and spleen of individuals with type 1 and type 2 diabetesbioRxiv - Cell Biology 2019Quote: ... Pancreas tissue sections (8 um) were stained using the following primary antibodies: guinea pig anti-insulin (DAKO; 1:500), goat anti-pancreatic polypeptide (abcam ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8–10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: VIGS-treated barley RNA samples were verified for quality by a Bioanalyzer 2100 instrument and hybridized to the custom 8×16K microarray per the manufacturer’s protocol (Agilent). Sixteen total samples were hybridized ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Cancer Biology 2022Quote: PBMs were performed on universal ‘all 10-mer’ arrays in 8 x 60K format (GSE AMADID # 030236, Agilent Technologies) essentially as described previously (Berger and Bulyk 2009 ...
-
bioRxiv - Cancer Biology 2023Quote: ... intact poly(A) RNA was purified from 100-500 ng of RNA (RIN 8-10, Agilent Technologies 2200 TapeStation) with oligo(dT ...