Labshake search
Citations for Agilent :
51 - 100 of 1705 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The plates were placed into a BioTek BioSpa 8 Automated Incubator (Agilent Technologies) and read by brightfield and fluorescence imaging on a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA integrity (RIN >8) was verified on the Agilent 2200 TapeStation (Agilent Technologies), and 400 ng RNA was used for multiplex library preparation with the KAPA mRNA HyperPrep Kit (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: Microarray mRNA analysis was performed using Agilent 8 × 60 K oligonucleotide microarrays (Agilent Technologies Inc. ...
-
bioRxiv - Developmental Biology 2019Quote: ... were subjected to a SurePrint G3 Mouse GE v2 8×60K Microarray (Agilent). The microarray data obtained for this study are deposited in the Gene Expression Omnibus database (GEO ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µl of each probe provided by Agilent was mixed with 8 µl IQFISH Fast Hybridization Buffer (#G9415A, Agilent Technologies, Inc).
-
bioRxiv - Neuroscience 2022Quote: ... and the integrity checked with a Bioanalyzer RNA pico chip (Agilent, RIN>8). cDNA libraries were prepared using a QuantSeq 3’ mRNA-Seq Library Prep kit FWD (Lexogen ...
-
bioRxiv - Immunology 2023Quote: Microarray analysis was performed using SurePrint G3 Mouse GE 8×60K slides (Agilent) and Partek Genomics Suite version 6.6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sections were then incubated with mouse anti-Ki67 (Dako, M724801-8, 1:200) or rabbit anti-Muc2 antibody (NBP1-31231 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and quality of total RNA was confirmed by BioAnalyzer 2100 (RIN > 8) (Agilent). cDNA was synthesized by SMART-Seq mRNA kit (Takara ...
-
bioRxiv - Biochemistry 2021Quote: ... 8×60K GSE ‘all 10-mer universal’ oligonucleotide arrays (AMADID #030236; Agilent Technologies, Inc.) were double-stranded and used in PBM experiments essentially as described previously ...
-
Chameleon microRNAs in breast cancer: their elusive role as regulatory factors in cancer progressionbioRxiv - Systems Biology 2020Quote: ... The samples were hybridized on Agilent 8×15K arrays (Agilent Technologies, Santa Clara, CA), catalogue number 4470B (v2 ...
-
bioRxiv - Genomics 2019Quote: ... and a well- established 8×60K fetal DNA chip (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2020Quote: A customized whole-genome DNA microarray of 630Δerm was used (8×15K format, Agilent) (50) ...
-
bioRxiv - Plant Biology 2019Quote: An 8×60K customized pea eArray (ID 045803, Agilent Technologies, Santa Clara, CA, USA) was used to scan the pea embryo transcriptome ...
-
bioRxiv - Developmental Biology 2021Quote: Transcriptomic profiling of the samples was performed with pikeperch-specific microarrays (8×60k, Agilent), which were designed and successfully validated previously (for details ...
-
bioRxiv - Developmental Biology 2021Quote: ... and hybridized with the custom microarrays (ID:085740, 8 x 60k arrays; Agilent Technologies) for 17h at 65°C ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Immunology 2022Quote: ... Assays were conducted using an XFp (8 well) system and analyzed using WAVE software (Agilent).
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... 800 rpm for 8 hours in a BioTek LogPhase 600 plate reader (Agilent Technologies, Inc.). Cell growth was monitored by measuring OD600 every 20 min ...
-
bioRxiv - Immunology 2021Quote: Agilent SurePrint G3 Mouse Gene Expression 8×60K Microarrays (Agilent Technologies, Santa Clara, CA, USA) were used for microarray experiments on purified CD4+CD25-CD62L-spleen lymphocytes ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For ER ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For CK5/6 ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). A monoclonal rabbit Ki67 antibody (M7240 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sections were immunostained using EnVision and ARK kits (DAKO, K400311-2 and K395411-8) according to manufacturer protocols ...
-
bioRxiv - Microbiology 2023Quote: ... RNA integrity number (RIN) was >8 for all samples (Agilent 1200 bioanalyzer, Alpha Metrix Biotech). Labeling of total RNA (100 ng ...
-
bioRxiv - Neuroscience 2020Quote: ... These data were obtained with Agilent SurePrint G3 Human GE v2 8×60K microarray (Agilent Technologies) from peripheral blood samples (all samples had RNA integrity number (RIN ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cRNAs were hybridized on a SurePrint G3 Mouse Gene Expression 8 × 60K Microarray (Agilent Technologies), and fluorescence signals were detected using the SureScan Microarray Scanner (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Genomics 2019Quote: ... and hybridized onto SurePrint G3 Rat GE 8 x 60K Microarrays v2 (AMADID 074036; Agilent Technologies) for 16-20 h at 65°C in an Agilent oven with rotisserie ...
-
bioRxiv - Immunology 2021Quote: ... antigen retrieval was performed in Tris buffer pH 8 with 10 mM EDTA (PT link, Agilent). Immunofluorescent staining was performed using the Bond RX Fully Automated Research Stainer (Leica biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Neuroscience 2020Quote: ... The microarray was performed using the SuperPrint G3 Mouse GE 8×60K Microarray Kit (Agilent, #G4852A) and a DNA microarray scanner ...
-
bioRxiv - Physiology 2021Quote: ... fed and active season bears were thawed and plated in 8-well Seahorse XFp Miniplates (Agilent) and processed as described above ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... achieving RNA integrity (RIN) in the range of 8-10 (Agilent Bioanalyzer Total RNA Pico Assay). First strand cDNA synthesis of DBD-specific regions was carried out using RevertAid H Minus Reverse Transcriptase (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... Total RNA was examined using the SurePrint G3 Mouse GE 8×60K Microarray (Agilent Technologies, USA.). Data were quantified using the Agilent Feature Extraction software (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... the analysis was performed using one color SurePrint G3 Human GE 8×60k Microarrays (Agilent Technologies), and the data is available in the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress ...
-
bioRxiv - Cell Biology 2022Quote: ... Frozen blocks were tested for RNA quality with RIN > 8 for frozen tissues (RNA pico, Agilent) and three tissue optimisation experiments (10x Genomics ...
-
bioRxiv - Genomics 2022Quote: ... RNA concentrations were quantified (Nanodrop) and subsequently analyzed via fragment analysis (BioAnalyzer, Agilent, all RIN > 8). RNA libraries were prepared using Illumina polyA total RNA kit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... An RNA integrity number > 8 was confirmed by Bioanalyzer RNA analysis (Agilent Technologies, Inc, CA, USA).
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Molecular Biology 2020Quote: Cybrid cells were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent, 103010-100). The day of the assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome, Agilent Technologies, design ID 074809) and subsequent washing and drying of the slides were performed following the Agilent hybridization protocol in Agilent hybridization chambers ...
-
bioRxiv - Physiology 2021Quote: ... Génopole Toulouse Midi-Pyrénées) using Sureprint G3 Mouse GE v2 microarrays (8×60K, design 074809, Agilent Technologies), according to the manufacturer's instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200 μl of distilled water was added to the sensor-containing Seahorse 8-well fluxpaks (Agilent Technology), which were coated with Poly-D-Lysine ...
-
bioRxiv - Biochemistry 2019Quote: ... all samples were processed and hybridized to SurePrint G3 Mouse Gene Expression 8 × 60 K (Agilent Technologies). Fluorescence was detected using Agilent DNA Microarray Scanner ...
-
bioRxiv - Neuroscience 2023Quote: Neurospheres were removed from 96-well plates and pipetted into 8-well Seahorse XF HS miniplates (Agilent) coated with 15 µg/mL poly-L-ornithine and 10µg/mL laminin ...
-
bioRxiv - Immunology 2024Quote: Initial experiments were conducted with an 8-well Seahorse XFp extracellular flux analyser (Seahorse Bioscience, Inc, USA) to determine cell seeding density and FCCP concentration (Supplementary Data) ...