Labshake search
Citations for Agilent :
1 - 50 of 3532 citations for 7H Pyrazolo 4 3 d pyrimidin 7 one 1 4 dihydro 3 b D ribofuranosyl oxime monohydrochloride 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Systems Biology 2019Quote: ... raw data files (.d) were processed using Profinder B.08.00 software (Agilent Technologies) with the following parameter settings ...
-
bioRxiv - Immunology 2021Quote: ... 3×105 CD8+ T cells were plated onto poly-D-lysine coated wells and assayed in XF RPMI medium (Agilent) pH 7.4 supplemented with 10 mM glucose and 2 mM glutamine ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2022Quote: Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Biochemistry 2023Quote: Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to a nitrocellulose membrane before probing using a primary anti IL-36γ antibody (Biotechne (R&D) UK) overnight at 4°C and a secondary goat antibody (Dako) for 1 hour at room temperature to visualise any protein cleavage.
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Microbiology 2021Quote: Aldehydes were analysed as oximes by using a headspace sampler (Agilent 7697A) coupled with gas chromatograph (Agilent 7890B ...
-
bioRxiv - Microbiology 2021Quote: ... D.03.00.611 (Agilent Technologies). Retention times were related to an injected Kovats linear alkane mixture of carbon chain length C8-C40 and linear retention indices for each peak were calculated (van Den Dool and Dec ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Neuroscience 2022Quote: ... Raw data (Agilent “.D” files) were analyzed using Agilent MassHunter software ...
-
bioRxiv - Plant Biology 2023Quote: ... raw “.D” files from Agilent were converted to “.CDF” format in Agilent Chemstation ...
-
bioRxiv - Immunology 2022Quote: ... Seahorse XF Cell Culture Microplates were pre-treated with poly-D-lysine and 106 primary B cells or 105 DG75 cells were plate in Seahorse XF Base Medium (Agilent) supplemented with 2mM L-glutamine (Agilent) ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Microbiology 2023Quote: ... The files generated by Agilent (*.d) were converted to the *.mzML format using MSConvert (63) ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
Suppression of the Integrated Stress Response in Islet β Cells Decreases Risk of Autoimmune DiabetesbioRxiv - Cell Biology 2023Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Developmental Biology 2019Quote: ... service pack 3 (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2A-D: Rabbit anti-GFAP (DAKO, Z033401-2); Fig ...
-
bioRxiv - Microbiology 2022Quote: ... LMP1 (CS1-4; Dako), CD81 (B399 ...
-
bioRxiv - Plant Biology 2019Quote: ... 1/4 pear sections from 4 fruits per replicate) were injected into a HP 5890A gas chromatograph (Agilent, Avondale, PA, USA) with a flame ionization detector (FID ...
-
bioRxiv - Immunology 2024Quote: ... Cells (1-2 × 105) were plated in Poly-D-Lysine coated 96-well microplates (Agilent) with 4-5 technical replicates ...