Labshake search
Citations for Agilent :
51 - 100 of 4982 citations for 7H Azeto 2 1 b 1 3 dioxino 4 5 e 1 3 oxazin 7 one hexahydro 2 6 dimethyl 2S 4aR 5aS 6S 9aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... GFAP (1:500, Z033429-2, Agilent, Santa Clara, CA), and IBA1 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse monoclonal anti-PCNA (1:300; M087901-2 Agilent); guinea pig polyclonal anti-Doublecortin (DCX ...
-
bioRxiv - Neuroscience 2023Quote: ... or Aβ (Dako, code: M087201-2; 1:40 dilution), together with hematoxylin ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-Lysozyme (Agilent, cat.# A009902-2; 1:300), rabbit anti-Aldolase B/C (Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... anti Ki67 (Agilent DAKO, M724029-2, dilution 1:200), anti-pSTAT-1 (Cell Signalling ...
-
bioRxiv - Microbiology 2024Quote: ... anti Ki67 (Agilent DAKO, M724029-2, dilution 1:200), anti-pSTAT-1 (Cell Signalling ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Microbiology 2021Quote: ... unfrationated 2-5A oligomers were run on an HPLC (1260 Infinity II Agilent technologies) equipped with a preparative Dionex column (BioLCRDNAPacRPA-100 ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... blocked for 1 hr in 2% BSA + 0.1% Tween20 + 1:50 normal goat serum (DAKO) in PBS and washed twice with PBS + 0.5% Tween ...
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-rabbit IgG (250 ng ml−1, 1% BSA in PBST; Agilent, P044801-2) or rabbit anti-goat IgG (500 ng ml−1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... E-cadherin (1:50, cat. #M3612, Agilent Dako), ZEB1 (1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... E-cadherin (1:50, cat. #M3612, Agilent Dako), ZEB1 (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: Total lysate and synaptoneurosomes isolated from cortex tissue of 1-month-old C57Bl/6 mice were UV crosslinked (100 mJ/cm2 for 2 cycles) using UV Stratalinker 2400 (Stratagene) and stored at −80°C until use ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated rabbit anti-mouse (Agilent, P0260022-2, 1:3000).
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated rabbit-anti-goat (Agilent, P016002-2; 1:3000), HRP-conjugated rabbit anti-mouse (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated goat-anti-rabbit (Agilent, P044801-2; 1:3000), HRP-conjugated rabbit-anti-goat (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... or rabbit anti-goat IgG (500 ng ml−1, 1% BSA in PBST; Agilent, P044901-2), for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies against proliferating cell nuclear antigen (PCNA-1, 1/200, sc-7907, Santa Cruz; PCNA-2, 1/200, M087901, Dako) were applied overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... E-cadherin IHC (Dako M3612 antibody at 1:100) was available for 172 of these tumors (7 IBC ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Hematoxylin and Eosin (H&E) (Agilent Technologies, #CS11830-2) staining was performed using the DAKO CoverStainer ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Z033401-2, 1:500 dilution; Dako, Agilent, Santa Clara, CA), GFP (GFP-1020 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Z033401-2, 1:500 dilution; Dako, Agilent, Santa Clara, CA), GFP (GFP-1020 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-CD45 (1:100, M070101-2, Dako Agilent Pathology Solutions), and/or mouse anti-MX1 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-CD45 (1:100, M070101-2, Dako Agilent Pathology Solutions), and/or mouse anti-MX1 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-CD68 (1:100, M081401-2, Dako Agilent Pathology Solutions), mouse anti-CD45 (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted at 1:10,000 with antibody diluent solution (DAKO, S080983-2), was also included as a positive control for the cell-based assay ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-CD68 (1:100, M081401-2, Dako Agilent Pathology Solutions), mouse anti-CD45 (1:100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... then primary antibody solution for Ki67 (#M724029-2, Agilent, 1:100) and NeuroD1 (#AF2746 ...
-
bioRxiv - Biophysics 2023Quote: ... an antibody mixture containing 1-part DAKO (Agilent, Cat#: S080983-2) and 4-parts goat serum was mixed to create a desired antibody dilution:
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was incubated with horseradish peroxidase-conjugated streptavidin (P0397; Dako; 1:3000, 3% BSA) at 4°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...