Labshake search
Citations for Agilent :
1 - 50 of 4644 citations for 7H 1 3 Thiazino 2 3 i purin 5 1H one 2 3 8 9 tetrahydro 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (S236784-2, DAKO, Carpinteria, CA, USA), for 20 min in a microwave oven ...
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Cell Biology 2022Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Physiology 2021Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Neuroscience 2019Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Neuroscience 2019Quote: ... Peptides were trapped on an in house made trap column (Dr Maisch Reprosil C18 column, 3 µm, 2 cm x 100 µm) and separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Genetics 2019Quote: ... 0.3 mL of the organic layer (the lower chloroform layer) was collected into a 2 mL amber glass vial (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Microbiology 2021Quote: ... A bright red chromogen labelling was produced with 3-amino-9-ethylcarbazole substrate (AEC, DAKO). Sections were counterstained with Mayer’s haematoxylin ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...