Labshake search
Citations for Agilent :
401 - 450 of 3128 citations for 7 methoxy 4 4 dimethylisochroman 1 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were incubated with primary antibodies for cytokeratin 7 (CK7; OV-TL 12/30,DAKO,Ready-to-Use), 3-mercaptopyruvate sulfurtransferase (MPST ...
-
bioRxiv - Genetics 2019Quote: ... and checked for a RIN number (≥ 7) to inspect RNA integrity by an Agilent Bioanalyzer 2100 (Agilent technologies). Qualified RNA was further purified by RNAClean XP Kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). Amplified cDNA libraries were constructed using SMART-seq v4 Ultra low Input RNA-kit (Takara ...
-
bioRxiv - Genomics 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). RNA was amplified using NuGen Ovation RNA amplification kit and sheared to an average size of 200 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Strand specific RNA sequencing was performed on quality controlled high RIN value (>7) RNA samples (Bioanalyzer Agilent Technologies). In brief ...
-
bioRxiv - Microbiology 2024Quote: ... Foci were manually counted from images obtained on Cytation 7 plate reader (Agilent Life Sciences, Santa Clara, CA). For mosquito infectivity ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... The anc-1 3’UTR RNAi construct was generated by PCR amplifying part of the 3’UTR-region of the anc-1 transcript using Paq5000™ DNA Polymerase (Agilent Technologies, 600682). The primer sequences are detailed in Table S2 ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Genomics 2019Quote: ... We required a minimal RIN (RNA Integrity Number) of 7 as measured using a Bioanalyzer (Agilent, Santa Clara, CA) with the Agilent RNA 6000 Nano Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat. no. 103575-100) supplemented with 10mM glucose (Agilent cat ...
-
bioRxiv - Biophysics 2023Quote: ... 104 and 140) cDNA in pET-7 vector was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of four single cysteine mutants (T26C ...
-
bioRxiv - Physiology 2023Quote: ... RNA concentration and integrity (RIN>7 for all samples) was assessed via Qubit fluorometric quantitation and tapestation bioanalyzer (Agilent), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Cancer Biology 2021Quote: Immunohistochemical staining of formalin-fixed, paraffin-embedded xenografts was performed after antigen retrieval (120°C, 7 min at pH9) and peroxidase blocking (Dako) using the UltraVision LP detection system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All liver RNA samples had integrity numbers (RIN) ≥ 7 as verified with the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany). A260/A280 were ≥ 1.8 as verified with Thermo Scientific™ NanoDrop 2000 spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...