Labshake search
Citations for Agilent :
1 - 50 of 881 citations for 7 chlorobenzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were digested by DpnI enzyme for 2h at 37°C (Agilent) and loaded on a 1% Agarose Gel ...
-
Physiological variation reflects bioclimatic differences in the Drosophila americana species complexbioRxiv - Evolutionary Biology 2019Quote: ... Each group of 20 flies was then lightly anesthetized and weighed as a group before being irradiated with UV-B light at one of the four experimental intensities using an ultraviolet Stratalinker 2000 (Stratagene, La Jolla, CA). For the 0J exposure - which essentially measures longevity in the absence of acute UV exposure - flies were simply anesthetized ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Physiology 2022Quote: ... [U-13C]-palmitate enrichment and [1,1,2,3,3-2H]-glycerol enrichment were measured by GC-MS/MS (Agilent GC model 7890A and Waters Quattro Micro) ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Cell Biology 2019Quote: ... One-Color (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... one color (Agilent Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... B.08.00 (Agilent Technologies, USA). A patchoulol standard (18450 ...
-
bioRxiv - Immunology 2022Quote: ... b) c-KIT− (DAKO-MA512944) (Nagasawa et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... B.08.00 (Agilent Technologies, USA). The National Institute of Standards and Technology (NIST ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated for 2h at room temperature with Horse Radish Peroxidase (HRP)-conjugated αMouse antibodies (Dako). After washing with TBS-Tween ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibody incubation lasted 2h and was followed by avidin-biotin complexes for signal amplification (ABC kit, Dako). Immunoreactivities were visualized using 3,3’-diaminobenzidine as a chromogen ...
-
bioRxiv - Molecular Biology 2021Quote: ONE-seq libraries from Agilent Technologies were resuspended in 10 mM tris buffer and amplified in a 100 µL reaction containing 2 µL of 5 nM library ...
-
bioRxiv - Cell Biology 2020Quote: ... MassHunter version B.06.00 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... Mass Hunter B.06.00 software (Agilent) was used to quantify isotopomer peak areas before natural abundance isotope correction was performed using an in-house algorithm.
-
bioRxiv - Molecular Biology 2022Quote: ... amplified and labeled with Cyanine 3 (Cy3) as instructed by the manufacturer of the One-Color Agilent Low Input Quick Amp Labeling Kit (Agilent Technologies, Les Ulis, France). Cy3-labeled cRNA was hybridized onto Agilent Whole Human Genome Oligo 8×60K V2 Arrays (SurePrint G3 Human Gene Expression 8×60K v2 Microarray Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... B=90% acetonitrile in water, both A and B containing 10mM ammonium acetate pH 9.0 and 5μM Agilent’s deactivator additive ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2h at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope.
-
bioRxiv - Cancer Biology 2021Quote: ... suspended in saline in 12 mm glass vials and 2H-MR spectra acquired using a 16 mm 2H single loop surface coil (DOTY Scientific) at a Varian 14.1T vertical MR scanner (Agilent Technologies). A pulse-acquire sequence (TR=260ms ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A chiral GC column (Cyclosil-B, Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... MassHunter Workstation (B.06.00 SP01, Agilent Technologies) was used for metabolite identification by comparison of retention times ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Qualitative Analysis B.06.00 software (Agilent Technologies) was used to export the m/z of precursor and product ions and retention time of target lipids in the multiple reaction monitoring data ...
-
bioRxiv - Physiology 2022Quote: ... release B.07.01 (Agilent Technology, Waldbronn Germany).
-
bioRxiv - Animal Behavior and Cognition 2019Quote: MassHunter Profinder B.08.00 (Agilent Technologies Inc.) was used to deconvolute ...
-
bioRxiv - Immunology 2019Quote: ... MassHunter Workstation (B.06.00 SP01, Agilent Technologies) was used for metabolite identification by comparison of retention times ...
-
bioRxiv - Immunology 2022Quote: ... for primary B cells 10mM glucose (Agilent), centrifuged at 200 x g at RT for 2 min without breaks and incubated for 30 min at 37°C in a CO2 –free incubator ...
-
bioRxiv - Cancer Biology 2023Quote: ... or anti-CA125 epitope group B (Agilent, M11 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Qualitative Analysis (version B.06.00, Agilent). Using standard curve to calculate the citrate content in tissue samples ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were analysed with solid phase microextraction (SPME) GC-MS (Agilent 7890 B and 5977 B MSD, Agilent, Inc.) with a Gerstel multipurpose sampler (MPS ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were analysed with solid phase microextraction (SPME) GC-MS (Agilent 7890 B and 5977 B MSD, Agilent, Inc.) with a Gerstel multipurpose sampler (MPS ...
-
bioRxiv - Microbiology 2024Quote: ... Metabolites were analyzed using Agilent Qualitative Analysis B.07.00 and Profinder B.07.00 software (Agilent Technologies, Santa Clara, CA, USA) with a mass tolerance of <0.005 Da ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-Mouse Envision-HRP (DAKO, one hour) as secondary antibody ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... closed with one-component-closure-caps (Agilent) at -80°C ...
-
bioRxiv - Biochemistry 2020Quote: ... B.06.01.6157 software (Agilent Technologies, Palo Alto, CA). All solvents were LC-MS grade (Fisher Scientific) ...