Labshake search
Citations for Agilent :
1 - 50 of 3985 citations for 7 chloro 1 5 naphthyridin 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Genomics 2019Quote: OLS libraries (Agilent Technologies, Santa Clara, CA) were resuspended to a final volume of 200 nM in TE pH 8.0 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... We then ordered the following oligo library (OL) from Agilent: 100k oligos (Extended Data Table 1) ...
-
bioRxiv - Synthetic Biology 2022Quote: To assemble an oligonucleotide Library Synthesis (OLS) Pool (oligo pool; Agilent) into an AAV genome ...
-
bioRxiv - Genomics 2022Quote: ... we took advantage of an improved HiFi OLS platform from Agilent, which led to reduced error rates such that 80% of our final Kir2.1 variants consist only of our designed mutations.
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Synthetic Biology 2019Quote: ... we synthesized a microarray-derived oligo library synthesis (OLS) pools of 33,792 230mer oligos from Agilent Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Microbiology 2022Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Systems Biology 2023Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Genetics 2023Quote: ... 128-nt oligos with pgRNA-coding sequences were synthesized with Agilent oligo library synthesis service (Agilent OLS, product No. G7261A) and then cloned into pCG-EGFP backbone using Gibson assembly ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cell Biology 2023Quote: ... bordered (∼ 5 x 2 cm rectangle) with a hydrophobic fat pen (Dako). A glass coverslip ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent, RIN score ≥ 7, 28S/18S ≥ 1). RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 minutes at room temperature and Oligo aCGH Wash Buffer 2 (Agilent) for 1 minute at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... anti-mouse (Dako P044701-2; 1:1000) Alexa Fluor 488 or anti-rabbit (#1706515 ...
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis, ready-to-use, incubation 20 min, Agilent Technologies, Santa Clara, CA, USA). Antibody detection was performed using EnVision FLEX/HRP (GV80011-2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... in a citrate buffer for 20 min at 95°C for TP53 (1:800, Dako, M7001 DO-7), BCL-10 (1:1000 ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 ml samples were injected with a split ratio of 7:1 into an Agilent GC-MS system (Agilent Inc, Palo Alto, CA) consisting of an 7890A gas chromatograph ...