Labshake search
Citations for Agilent :
151 - 200 of 358 citations for 7 Phenyl acetamido deacetoxy cephalosporanic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Plant Biology 2019Quote: ... The resulting fatty acid methyl esters were analyzed using GC/MS (Agilent Technologies, Wilmington, DE) equipped with a capillary DB-23 column (30 m × 0.25 mm × 0.25 μm ...
-
bioRxiv - Neuroscience 2019Quote: ... Fatty acid separation was performed on an Infinity 1260 HPLC binary system (Agilent Technologies, France) equipped with a ZORBAX SB-C18 C18 50 × 2.1 mm 1.8 μm (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... B: Acetonitrile: Methanol − 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Physiology 2020Quote: The fatty acid oxidation (FAO) was measured using a microfluorimetric Seahorse XF96 Analyzer (Agilent Technologies) according to the protocol supplied by the manufacturer with minor modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... B: Acetonitrile: Methanol – 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Systems Biology 2024Quote: ... and amino acids was performed using gas chromatography-mass spectrometry (Agilent, GC-7890A, MS-5975C). Before the extraction of intracellular metabolites ...
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cell Biology 2022Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent).
-
bioRxiv - Cell Biology 2019Quote: A fluorescein-conjugated peptide nucleic acid (PNA) telomere detection kit for flow cytometry (Cat.#K5327, Dako) was used following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Amino acids were then converted into respective fluorescent derivatives using o-phthalaldehyde (OPA) (Agilent #5061-3335). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentrations of glucose and organic acids were detected by a HPLC (Agilent 1260, Waldbronn, Germany) equipped with a refractive index detector (RID) ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Physiology 2023Quote: ... amino acids and nicotinamide adenine dinucleotide reduced (NADH) and oxidized (NAD+) forms) was created from Agilent METLIN PCDL for identification within the samples ...
-
bioRxiv - Synthetic Biology 2023Quote: The residual glucose and organic acids were analyzed using high performance liquid chromatography (HPLC, Agilent, USA) equipped with a refractive index detector (RID ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: An FT-ICR-MS (7 Tesla, SolariXR, Bruker, Bremen, Germany) was used in the flow-injection mode (a HPLC 1260 Infinity from Agilent (Waldbronn, Germany) was used) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples typically yielded >100ng of RNA with a RIN value of > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2023Quote: ... the proteins were loaded in a Shodex PH-814a hydrophobic interaction chromatography column and eluted with a (NH4)2SO4 gradient in Hepes 25 mM pH 7 on a HPLC system (Agilent 1200, USA). The recovered fractions were separated by SDS-PAGE on 12% gels ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified by 7 cycles and the total yield of cDNA was assessed on High Sensitivity DNA Assay (Agilent 2100 Bioanalyzer) resulting on average in 168 ng ...
-
bioRxiv - Systems Biology 2023Quote: ... 7 cycles were used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System) and DNA 7500 (Agilent 2100 Bioanalyzer) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mutations in amino acid position 339 of KLF1 were introduced by site directed mutagenesis (Agilent Technologies), primers are available upon request ...