Labshake search
Citations for Agilent :
101 - 150 of 4104 citations for 7 Oxabicyclo 2.2.1 hept 2 ene 5 6 6 trifluoro 1 methyl 1R 4S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was heated to 40°C for an isocratic 6-minute run paired with a 5977B GC/MSD (Agilent).
-
bioRxiv - Genetics 2024Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Developmental Biology 2023Quote: ... was used to produce Methyl-Seq libraries using a SureSelectXT Methyl-Seq Target Enrichment System with a mouse enrichment panel (Agilent #G9651B and #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Cell Biology 2022Quote: ... and SureSelectXT Mouse Methyl-Seq Reagent Kit (Agilent Catalog # 931052) ...
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Cell Biology 2021Quote: ... and 299.294 m/z (Methyl Stearate; Agilent article number G1982-85003) were used to recalibrate spectra during the acquisition.
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Molecular Biology 2020Quote: ... were induced with 2μg/mL doxycycline for 6 hours prior to crosslinking at 100mJ/cm2 at 4°C in a Stratalinker 1800 (Stratagene). Cells were then processed according to the eCLIP protocol for input and immunoprecipitated samples until cDNA was obtained ...
-
bioRxiv - Cell Biology 2021Quote: ... The C18 StageTips were constructed in-house using 6 layers 3M Empore solid phase extraction C18 (Octadecyl) membrane (Agilent Technologies) inserted into a 200 μL LoBind micropipette tip ...
-
bioRxiv - Immunology 2022Quote: ... and exonic splicing elements (ΔESE2 and ΔESS3) in IL7R exon 6 were introduced using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Pathology 2022Quote: Exonic sequences were enriched in the DNA sample of patient II-6 using SureSelect Human All Exon 50 Mb Kit (Agilent Technologies ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA from various tissues (Supplemental Table 6) was purified and used for library construction with target enrichment using the SureSelectQXT Target Enrichment kit (Agilent). Custom RNA capture probes were designed to hybridize with the 120 bp 5’ ends of the 5’LTRs and the 120 bp 3’ ends of the 3’LTR of about 600 intact (internal region flanked by two LTRs ...
-
bioRxiv - Microbiology 2020Quote: ... Small RNAs (6–150 nucleotides) and microRNA fractions (10–40 nucleotides) were quantified using high-resolution small RNA analysis (Agilent 2100 Bioanalyzer system ...
-
bioRxiv - Cell Biology 2020Quote: ... The equivalent of 6 ng of resulting cDNA was used as a template for real time PCR using a Mx3000P thermocycler (Agilent) with a home-made SYBR Green qPCR master mix (Lutfalla & Uze ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Neuroscience 2023Quote: ... Mitochondrial bioenergetics were assessed at 6 weeks of differentiation using the Mitochondrial Stress Test measured on a Seahorse XFe96 Analyzer (both Agilent). Stress tests were carried out according to manufacturer’s instructions and cycling parameters ...
-
bioRxiv - Immunology 2023Quote: For CFTR detection in cross sections, target retrieval was performed with a citrate buffer (Target Retrieval solution, pH 6, (Dako) for 30min after deparaffinization ...
-
bioRxiv - Physiology 2024Quote: ... MLO-Y4 cells with Pparγ silenced with siRNA (γY4KD) and their scrambled control (Scrl) were plated 6 hrs before the assay onto Seahorse cell culture microplates (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was passed up and down through a 29-gauge needle 6-8 times and the fragment size distribution was determined (∼30 kbp; TapeStation, Agilent).
-
bioRxiv - Immunology 2023Quote: ... antigen retrieval using sodium citrate buffer (10 mM, pH 6) was performed for 15 min at 110 °C in a DAKO Pascal pressure chamber (Agilent). After blocking in PBS supplemented with 10% goat serum (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were loaded on a Superose 6 Increase column (Cytiva) run by a 1260 Infinity II HPLC (Agilent Technologies) at 0.6 mL/min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Different FMv2-MDM4 versions containing mutations or deletions of single or combined L22 consensus sequences in MDM4 intron 6 were generated by QuikChange site-directed mutagenesis (200516, Agilent).
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent, #5191-6704) following the manufacturer’s recommendations ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... For ChR2-mediated optogenetic stimulation, blue light (473 nm, 6 Hz or 20 Hz) was produced using an arbitrary waveform generator (Agilent, 33220A) and a diode-pumped solid-state laser (Laserglow ...
-
bioRxiv - Developmental Biology 2019Quote: ... The quality of the purified DNA library was assessed on 6%TBE gels as well as on a Bioanalyzer (2100 Expert software, Agilent Technologies) using High Sensitivity DNA Chips (5067-4626 ...
-
bioRxiv - Developmental Biology 2020Quote: ... RIN scores (RIN = 10 for all 6 samples) were measured on a BioAnalyzer 2100 using the RNA 6000 Nano assay (Agilent Technologies). Poly(A)-purified mRNA-seq library preparation was performed according to the TruSeq Stranded mRNA Reference Guide (Illumina) ...
-
bioRxiv - Synthetic Biology 2021Quote: Thermal denaturation experiments were performed using a qCHANGER 6/Cary60 (Quantum Northwest) interfaced to a Cary 60 UV-Visible spectrophotometer (Agilent Technologies) using a custom ADL script developed by Quantum Northwest to collect full spectra at each temperature as described previously ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 6 minutes (30 seconds ON, 30 seconds OFF) at 4°C to obtain ~200 bp fragments (confirmed using an Agilent Bioanalyzer). Sonicated DNA was extracted using ethanol precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: The complex formation between CtBP1 and CtBP2 variants and RAI2 variants was investigated on an analytical Superose 6 3.2/300 GL column (Cytiva, MA, USA) coupled to a 1260 Infinity HPLC system (Agilent, CA, USA). Proteins were dialyzed against the SEC buffer and injected onto a pre-equilibrated S6 column using an autosampler ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.