Labshake search
Citations for Agilent :
51 - 100 of 108 citations for 7 OCTENENITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... magnetic resonance data were acquired with a 7 T horizontal magnet Agilent ASR 310 (Agilent Technologies Inc.) equipped with nested 205/120/HDS gradient insert and a bore size of 310 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation as with the mitochondrial stress test astrocytes were transferred to XFmedia (Agilent) and glycolysis was assessed ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were incubated with primary antibodies for cytokeratin 7 (CK7; OV-TL 12/30,DAKO,Ready-to-Use), 3-mercaptopyruvate sulfurtransferase (MPST ...
-
bioRxiv - Genetics 2019Quote: ... and checked for a RIN number (≥ 7) to inspect RNA integrity by an Agilent Bioanalyzer 2100 (Agilent technologies). Qualified RNA was further purified by RNAClean XP Kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). Amplified cDNA libraries were constructed using SMART-seq v4 Ultra low Input RNA-kit (Takara ...
-
bioRxiv - Genomics 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). RNA was amplified using NuGen Ovation RNA amplification kit and sheared to an average size of 200 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Strand specific RNA sequencing was performed on quality controlled high RIN value (>7) RNA samples (Bioanalyzer Agilent Technologies). In brief ...
-
bioRxiv - Cancer Biology 2022Quote: ... in a citrate buffer for 20 min at 95°C for TP53 (1:800, Dako, M7001 DO-7), BCL-10 (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Foci were manually counted from images obtained on Cytation 7 plate reader (Agilent Life Sciences, Santa Clara, CA). For mosquito infectivity ...
-
bioRxiv - Genomics 2019Quote: ... We required a minimal RIN (RNA Integrity Number) of 7 as measured using a Bioanalyzer (Agilent, Santa Clara, CA) with the Agilent RNA 6000 Nano Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat. no. 103575-100) supplemented with 10mM glucose (Agilent cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... the beads were transferred into a 1-mL PP filtration microplate (Agilent, 7 µm frit, cat. no. 202501-100) and washed 3x with 200 µL 1x PBS and 2x 200 µL ultrapure water ...
-
bioRxiv - Biophysics 2023Quote: ... 104 and 140) cDNA in pET-7 vector was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of four single cysteine mutants (T26C ...
-
bioRxiv - Physiology 2023Quote: ... RNA concentration and integrity (RIN>7 for all samples) was assessed via Qubit fluorometric quantitation and tapestation bioanalyzer (Agilent), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cancer Biology 2021Quote: Immunohistochemical staining of formalin-fixed, paraffin-embedded xenografts was performed after antigen retrieval (120°C, 7 min at pH9) and peroxidase blocking (Dako) using the UltraVision LP detection system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All liver RNA samples had integrity numbers (RIN) ≥ 7 as verified with the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany). A260/A280 were ≥ 1.8 as verified with Thermo Scientific™ NanoDrop 2000 spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: An FT-ICR-MS (7 Tesla, SolariXR, Bruker, Bremen, Germany) was used in the flow-injection mode (a HPLC 1260 Infinity from Agilent (Waldbronn, Germany) was used) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples typically yielded >100ng of RNA with a RIN value of > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2023Quote: ... the proteins were loaded in a Shodex PH-814a hydrophobic interaction chromatography column and eluted with a (NH4)2SO4 gradient in Hepes 25 mM pH 7 on a HPLC system (Agilent 1200, USA). The recovered fractions were separated by SDS-PAGE on 12% gels ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified by 7 cycles and the total yield of cDNA was assessed on High Sensitivity DNA Assay (Agilent 2100 Bioanalyzer) resulting on average in 168 ng ...
-
bioRxiv - Systems Biology 2023Quote: ... 7 cycles were used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System) and DNA 7500 (Agilent 2100 Bioanalyzer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA samples yielded >280ng of RNA (>5.6ng/µl in a total eluate of 50µl) with a RIN value of generally > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2019Quote: The monkeys were scanned on an actively shielded 7-Tesla 68-cm horizontal bore scanner with a DirectDrive console (Agilent, Santa Clara, California) with a Siemens AC84 gradient subsystem (Erlangen ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 ml samples were injected with a split ratio of 7:1 into an Agilent GC-MS system (Agilent Inc, Palo Alto, CA) consisting of an 7890A gas chromatograph ...