Labshake search
Citations for Agilent :
301 - 350 of 737 citations for 7 N Fmoc aminocoumarin 4 acetic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular fatty acids were extracted and determined from dried cells by using GC (model 7890A, Agilent, USA) according to the protocol of the Sherlock Microbial Identification System (61) ...
-
bioRxiv - Physiology 2024Quote: ... Total bile acids assay (Diazyme Laboratories, CA, USA) and BioTek Epoch Microplate Spectrophotometer (Agilent Technologies, CA, USA) were used to measure total BA concentrations to determine the volume of cholestyramine-untreated extract needed to add for a final concentration of ∼300 μM BAs in the ileal explant culture media ...
-
bioRxiv - Immunology 2024Quote: ... Amino acid substitutions in G12V-TCR were generated by quick-change site-directed PCR mutagenesis (Agilent, USA). TCRs were transiently transfected into 293T-mCD3-GFP cells and stained separately with PE anti-mTCRβ mAb (Biolegend ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA samples yielded >280ng of RNA (>5.6ng/µl in a total eluate of 50µl) with a RIN value of generally > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2019Quote: The monkeys were scanned on an actively shielded 7-Tesla 68-cm horizontal bore scanner with a DirectDrive console (Agilent, Santa Clara, California) with a Siemens AC84 gradient subsystem (Erlangen ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 ml samples were injected with a split ratio of 7:1 into an Agilent GC-MS system (Agilent Inc, Palo Alto, CA) consisting of an 7890A gas chromatograph ...
-
bioRxiv - Cell Biology 2020Quote: ... and Nup133-mEGFP(-7) were cloned from the repair template plasmids constructed above via the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). For each CRISPR cell line ...
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis, ready-to-use, incubation 20 min, Agilent Technologies, Santa Clara, CA, USA). Antibody detection was performed using EnVision FLEX/HRP (GV80011-2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quality of the RNA samples (RIN score >7) was verified on the Agilent 2100 Bioanalyzer using the RNA 6000 kit (Agilent, cat# 5067-1513). 1 µg of each RNA sample was then used for poly(A ...
-
bioRxiv - Biochemistry 2022Quote: ... with 4 cycles per step using Seahorse XFe96 Analyzer (Agilent). Cell Mito Stress Test was used for assessing mitochondrial function ...
-
bioRxiv - Biophysics 2019Quote: ... A 4 mm triple-resonance HXY MAS NMR probe (Agilent) was used under static condition ...
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Microbiology 2021Quote: ... Each lipid spot was extracted for quantification of fatty acids by gas chromatography-mass spectrometry (Agilent 5977A-7890B) after methanolysis ...
-
bioRxiv - Microbiology 2019Quote: ... Each lipid spot was extracted for quantification of fatty acids by gas chromatography-mass spectrometry (Agilent 5977A-7890B) after methanol lysis ...
-
bioRxiv - Cell Biology 2019Quote: VARIAN PL-Microspheres SuperCarbonyl White poly(styrene-co-methancrylic acid) 20 μm in diameter (Batch CD185, Agilent Technologies) were coated as described 13 ...
-
bioRxiv - Neuroscience 2019Quote: The bile acid level in plasma samples was measured using HPLC-MS/MS (Agilent model LC1260 QQQ 6495). Chromatographic separation was performed in an ACQUITY UPLC HSS T3 column (2.1 mm × 100 mm ...
-
bioRxiv - Bioengineering 2021Quote: ... Mutagenesis of individual amino acid residues in KRaION1 was done using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Forward and reverse primers used to generate each mutant are provided in Supplementary Table 6 ...
-
bioRxiv - Microbiology 2020Quote: ... and Sialic acids from the purified S-Ectodomain was performed by using a Deglycosylation kit (Agilent, CA, USA) as per the manufacturer instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cell Biology 2020Quote: ... ShhHA and C25SShhHA (HA inserted between amino acids 197 and 198) were generated by site-directed mutagenesis (Stratagene). Unlipidated C25SShhN cDNA and non-palmitoylated C25AShh cDNA (amino acids 1-438 ...
-
bioRxiv - Immunology 2021Quote: Short chain fatty acid concentrations were determined using gas chromatography (3800 Varian GC, Agilent Technologies, Santa Clara, CA). For each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amino acid substitutions in the C-terminal (126-250) truncation were created via QuikChange site-directed mutagenesis (Agilent). pDEST-mCherry-LacR-RIF1 (1-567 ...
-
bioRxiv - Plant Biology 2023Quote: ... The chromatographic separations of free amino acids were carried out using a HILIC-Z column (2.1×150 mm, particle size 2.7 µm, Agilent) employing a linear binary gradient of (A ...
-
bioRxiv - Neuroscience 2023Quote: ... Single amino acid substitutions of GLIC were engineered using the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and oligonucleotide primers (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange® Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... variants of CaMKII with N-terminal His6-SUMO tag were co-expressed with λ phosphatase in Escherichia coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) in LB medium at 16 □ for 24 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step DNA was purified by Ampure XP beads (Beckmann Coulter Genomics #A63882) ...
-
bioRxiv - Cancer Biology 2019Quote: Whole Human Genome Microarray Kit 4×44K (Agilent, Cat. No. G4112F) was used to detect mRNA expression levels in cells transfected with control and miR-101-3p transfected HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...