Labshake search
Citations for Agilent :
101 - 150 of 231 citations for 7 Methoxy 6 azaindole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Immunology 2019Quote: ... or low pH antigen retrieval buffer (Dako Target retrieval Solution, pH 6, Dako, Denmark) (for PCNA) ...
-
bioRxiv - Immunology 2021Quote: ... mouse thymocytes were exposed to 254 nm UV-irradiation for 6 minutes (Stratagene Stratalinker) followed by labelling with 2 μM CFSE (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were used: guinea pig anti-insulin 1:6 (Agilent, IR002), rabbit anti-glucagon 1:200 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2023Quote: ... the heat-induced antigen retrieval was performed in Target Retrieval solution (pH 6) (Dako) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: Heat-induced antigen retrieval was performed in either Target Retrieval solution (pH 6) (Dako) or in EDTA (pH 8.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was carried out using citrate buffer solution pH 6 (Dako, Glostrup, Denmark). Detection was performed using the EnVision method (Dako ...
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Genetics 2019Quote: ... slides were incubated in antigen retrieval solution (Target Retrieval Solution Citrate pH 6; Dako cytomation) at 98°C for 20 minutes and then cooled at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... or hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: An FT-ICR-MS (7 Tesla, SolariXR, Bruker, Bremen, Germany) was used in the flow-injection mode (a HPLC 1260 Infinity from Agilent (Waldbronn, Germany) was used) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples typically yielded >100ng of RNA with a RIN value of > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2023Quote: ... the proteins were loaded in a Shodex PH-814a hydrophobic interaction chromatography column and eluted with a (NH4)2SO4 gradient in Hepes 25 mM pH 7 on a HPLC system (Agilent 1200, USA). The recovered fractions were separated by SDS-PAGE on 12% gels ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified by 7 cycles and the total yield of cDNA was assessed on High Sensitivity DNA Assay (Agilent 2100 Bioanalyzer) resulting on average in 168 ng ...
-
bioRxiv - Systems Biology 2023Quote: ... 7 cycles were used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System) and DNA 7500 (Agilent 2100 Bioanalyzer) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were microwaved in pH 6 antigen retrieval solution (1X Target Retrieval Solution, Agilent Cat # S1699) to bring near to ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...
-
bioRxiv - Immunology 2023Quote: ... Heat-induced epitope retrieval was performed for 15 min in Target Retrieval solution (pH 6) (Dako) and all other steps were as described above for mouse snout processing ...
-
bioRxiv - Immunology 2024Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (pH 6 or pH 9) (Dako, Glostrup, Denmark) for at least 15 minutes in an autoclave ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA samples yielded >280ng of RNA (>5.6ng/µl in a total eluate of 50µl) with a RIN value of generally > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2019Quote: The monkeys were scanned on an actively shielded 7-Tesla 68-cm horizontal bore scanner with a DirectDrive console (Agilent, Santa Clara, California) with a Siemens AC84 gradient subsystem (Erlangen ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 ml samples were injected with a split ratio of 7:1 into an Agilent GC-MS system (Agilent Inc, Palo Alto, CA) consisting of an 7890A gas chromatograph ...
-
bioRxiv - Cell Biology 2020Quote: ... and Nup133-mEGFP(-7) were cloned from the repair template plasmids constructed above via the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). For each CRISPR cell line ...
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis, ready-to-use, incubation 20 min, Agilent Technologies, Santa Clara, CA, USA). Antibody detection was performed using EnVision FLEX/HRP (GV80011-2 ...