Labshake search
Citations for Agilent :
551 - 600 of 776 citations for 7 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein lysates were incubated at 4°C with a mouse monoclonal antibody directed against the FLAG-tag (M2, Stratagene). Immunocomplexes were pulled down by incubation with protein G sepharose ...
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting 40 samples were diluted 4:1 with Buffer A for Multiple Affinity Removal LC Columns (Agilent Technologies), filtered through a 0.22 μm hydrophilic PVDF membrane filter plate (Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% BSA and 0.4% triton X-100) followed by incubation overnight at 4°C with 1:500 rabbit anti-C3 antibody (Dako) and 1:10,000 guinea pig anti-vGluT2 (Synaptic Systems ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the cells were washed twice with 200 μL/well of assay medium (XF DMEM Base Medium, pH 7.4 containing 25 mM Glucose and 4 mM Glutamine; Agilent). After washing ...
-
bioRxiv - Physiology 2021Quote: ... Samples were incubated overnight at 4°C in primary antibodies targeting anti-insulin (1:200, Abcam #Ab7872, Dako #A0564), anti-glucagon (1:100 ...
-
bioRxiv - Plant Biology 2021Quote: ... A total of 4 µL of each filtered sample was loaded onto a C18 high-capacity nanoLCchip (Agilent Technologies) using a 1200 series capillary pump (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gene expression analysis was conducted using Agilent Whole Mouse Genome 4×44 multiplex format oligo arrays (Agilent Technologies 014868) following the Agilent 1-color microarray-based gene expression analysis protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Pathology 2022Quote: ... DNA microarray analysis was performed using a Quick Amp labeling kit and a Whole Human Genome DNA Microarray 4×44K according to the manufacturer’s protocol (Agilent). Signal intensity was normalized by adjusting the data to a 75th percentile value ...
-
bioRxiv - Neuroscience 2021Quote: iNeurons were replated on DIV 4 onto polyornithine/laminin coated in the Seahorse XF96 Cell Culture Microplate (Agilent Technologies) at a density of 50 000/well ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The spinal cord tissue was dissected and packed into a 4 mm zirconium rotor (Agilent Techonology Inc., CA, USA) with 50 μL of D2O saline (0.9% ...
-
bioRxiv - Microbiology 2021Quote: ... and Tyr 254 in TlpALBD were generated via site-directed mutagenesis of pBH4_TlpALBD with primers listed in Supplemental Table 4 (QuikChange, Stratagene). TlpALBD and all point mutants were purified as described by Sweeney et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and C21 was accomplished using a C18 Security guard cartridge (4.6 × 4 mm) and Zorbax Extend-C18 column (4.6 × 75 mm, 3.5 μm, Agilent 766953-902) at 40 °C (mobile phase A = H2O + 0.1% formic acid ...
-
bioRxiv - Physiology 2024Quote: ... Sections were fixed with 0.2% glutaraldehyde + 4% PFA and mounted with Glycergel Mounting Medium (Agilent Technologies, Santa Clara, CA). The antisense probe generated with T7 polymerase showed the specific signal ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated overnight at 4°C with primary antibodies in DAKO REALTM Anti-body diluent (Agilent, Cat#S2022). Secondary antibodies (1:500 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 technical replicates for each time point were analysed using Microwave Plasma - Atomic Emission Spectrometry (MP-AES 4210, Agilent) as reported previously24.
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Molecular Biology 2019Quote: ... or humanized Renilla luciferase (5’-CCC CGA GCA ACG CAA AC-3’ and 5’-GCA CGT TCA TTT GCT TGC A-3’) and in 1x Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies). The reaction and fluorescence readout were performed in Rotor-Gene 6200 (Corbett Life Science ...
-
bioRxiv - Bioengineering 2019Quote: ... Removal of the native splice acceptor in the 3’ homologous arm of HDR templates was achieved via site-directed mutagenesis (Agilent Technologies, 200523).
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed in TBST (3 × 15 mins at RT) and then incubated with corresponding peroxidase-conjugated secondary antibodies (Dako, P0447, P0448) for 1h at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... was performed on 3-μm thick tissue sections using split signal FISH DNA probes for BCL2/18q21 (probe Y5407; DAKO A/S), BCL6/3q27 (probe Y5408 ...
-
bioRxiv - Bioengineering 2019Quote: ... Then endogenous peroxidase block was performed by using 3% H2O2 in water to cancel the interference of peroxidase in the final step.[33] Protein block buffer (Dako Protein Block) was used to treat the tissue slides to mask the non-specific binding sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were finally washed for 3 × 10min with PBS before mounting them on glass coverslips with Dako fluorescence conserving media (Dako, Hamburg, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... followed by incubation with 3% hydrogen peroxide to quench endogenous peroxidase activity and 15 minutes in serum-free protein block (DAKO, Glostrup, Denmark). Sections were then subjected to appropriate antigen retrieval methods (if needed ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cancer Biology 2020Quote: To construct RNA-seq libraries from C.elegans samples, we used an automated QuantSeq 3’mRNA-seq (Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Cell Biology 2020Quote: ... embryos were washed 3 times in PBV and transferred onto a glass microscope slide with DAKO mounting medium (Dako Inc., Carpinteria, California) and enclosed with a coverslip using a spacer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA libraries were assessed for quality and quantification according to the Chromium Single Cell 3’ Reagent kit v3 user guide using the High Sensitivity D5000 ScreenTape (Agilent 5067-5592) and 2200 TapeStation Controller software (Agilent ...