Labshake search
Citations for Agilent :
301 - 350 of 3885 citations for 7 FLUORO 1 2 3 4 TETRAHYDRO NAPHTHALEN 2 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 images at the central callus and distal callus regions were taken using an automatic microscope (Agilent, BioTek Lionheart FX, Santa Clara, CA). Central callus regions were defined as proximal to the fracture site on either side of the bone ...
-
bioRxiv - Neuroscience 2022Quote: ... with ODS column (2 x 50 mm, 2 μm) coupled to Agilent LC/MSD TOF MS system (Agilent Technologies Inc, Wadbronn, Germany). For chromatographic separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... and blocked with Protein-Block reagent (Dako, X090930-2) at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed three times in wash buffer (Dako, K800721-2), and blocked with 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μl of sample was subjected to TapeStation (Agilent) analysis to ascertain band sizes ...
-
bioRxiv - Cancer Biology 2019Quote: ... and transformed into electrocompetent SURE 2 cells (Agilent, #200152). Transformants were inoculated into 500 ml of 2xYT media containing 100 μg/ml carbenicillin and incubated overnight at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... and rabbit anti-human myeloperoxidase (A039829-2, Dako, USA) at 1:300 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... and anti-rabbit IgG HRP-linked (P044801-2, Dako). The IRE1 inhibitor STF083010 was purchased from Merck Life Science ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2022Quote: ... For detection the EnVision detection system (K500711-2, Dako) was used.
-
bioRxiv - Molecular Biology 2019Quote: ... and UV-crosslinked (2×2400 μJoules, Stratagene UV crosslinker) in two P15 Petri dishes on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... EnVision+ Dual Link HRP secondary (Agilent, Cat#K406311-2), and the ImmPACT DAB Peroxidase (HRP ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Neuroscience 2021Quote: ... XL-2 Blue ultracompetent bacterial cells (#200150, Agilent Technologies) were subsequently transformed with the ligation mixture and the resulting bacterial cell clones were screened by PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... and mouse monoclonal anti-α-SMA (M085129-2, Dako), Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were treated by Bluing Buffer (Agilent, CS70230-2) at RT for 2 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 2 mM Seahorse XF Glutamine Solution (Agilent) at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a 30-minute protein block (Dako, X090930-2) before incubating with H3K36me3 primary antibody (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... rabbit anti-mouse IgG HRP (Agilent technologies/P044701-2), goat anti-rat IgG HRP (Abcam/ab57057 ...
-
bioRxiv - Microbiology 2023Quote: ... Antibody diluent (Agilent, Santa Clara, CA, USA, # S302283-2) was used as a negative reagent control to replace the primary antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were treated with Protein Block (Dako, #X090930-2) then incubated with primary F4/80 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Genomics 2022Quote: ... 75µL of Dako Bluing Buffer (Agilent Technologies, CS70230-2) was added to each tissue section well ...
-
bioRxiv - Cell Biology 2023Quote: ... Horseradish Peroxidase-conjugated Goat Anti-Rabbit (Dako P044801-2) and Rabbit Anti-Mouse (Dako P044701-5 ...
-
bioRxiv - Genetics 2023Quote: ... in 2 ml glass vials (Agilent Technologies, Waldbronn, Germany) on an orbital shaker (IKA KS 130 Basic ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mounted with Dako mounting medium (#S302380-2, Agilent). The following primary antibodies were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM l-glutamine (Agilent Technologies, Cat. 103579-100) and 1mM pyruvate (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... with DAKO Fluorescent Mounting Medium (Agilent, cat. #S302380-2).
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies diluted in antibody diluent (S080983-2, Dako) were applied on sections for overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... were diluted in Antibody Diluent (Agilent/Dako, S302283-2). Antibody binding was performed in a humidity chamber for 1.5 hours for primaries and 30 minutes for secondaries ...
-
bioRxiv - Molecular Biology 2023Quote: ... were diluted in Antibody Diluent (Agilent/Dako, S302283-2). Antibody binding was performed in a humidity chamber for 1.5 hours for primaries and 30 minutes for secondaries ...
-
bioRxiv - Microbiology 2023Quote: ... using a multimode plate reader (Synergy 2, Biotek/Agilent) (55) ...
-
bioRxiv - Cell Biology 2024Quote: ... EnVision FLEX TRS High pH (Agilent Cat# GV80411-2), EnVision FLEX TRS Low pH (Agilent Cat# GV80511-2) ...
-
bioRxiv - Cell Biology 2024Quote: ... EnVision FLEX TRS Low pH (Agilent Cat# GV80511-2), MACH4 universal HRP polymer (Biocare Medical Cat#M4U534L) ...
-
bioRxiv - Cell Biology 2024Quote: ... HRP-conjugated anti-mouse Ig (Agilent Cat# K400111-2), MACH4 universal HRP-Polymer (Biocare Medical Cat#M4U534L) ...